Ube2l3 (NM_009456) Mouse Untagged Clone
CAT#: MC209609
Ube2l3 (untagged) - Mouse ubiquitin-conjugating enzyme E2L 3 (Ube2l3), (10ug)
"NM_009456" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ube2l3 |
Synonyms | C79827; Ubce7; UbcM4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209609 representing NM_009456
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAGATCCGCAAATGTGGAATGAAAAACTTCCGTA ACATCCAGGTTGATGAAGCTAATTTATTGACTTGGCAAGGGCTTATTGTTCCTGACAACCCTCCATATGA TAAGGGAGCCTTCAGAATTGAAATCAACTTTCCAGCAGAGTATCCATTCAAACCACCCAAGATCACATTT AAAACAAAGATCTACCACCCTAACATCGATGAGAAGGGGCAGGTCTGTCTGCCAGTCATTAGTGCTGAAA ACTGGAAGCCAGCCACCAAGACTGACCAAGTAATCCAGTCCCTCATAGCACTGGTGAATGACCCCCAGCC TGAGCACCCACTCCGGGCTGACCTAGCTGAAGAATACTCTAAGGACCGTAAAAAATTCTGTAAGAATGCT GAAGAGTTTACAAAGAAATATGGGGAAAAGCGACCTGTGGACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009456 |
Insert Size | 465 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_009456.2, NP_033482.1 |
RefSeq Size | 2609 bp |
RefSeq ORF | 465 bp |
Locus ID | 22195 |
UniProt ID | P68037 |
Cytogenetics | 16 10.63 cM |
Gene Summary | Ubiquitin-conjugating enzyme E2 that specifically acts with HECT-type and RBR family E3 ubiquitin-protein ligases. Does not function with most RING-containing E3 ubiquitin-protein ligases because it lacks intrinsic E3-independent reactivity with lysine: in contrast, it has activity with the RBR family E3 enzymes, such as PRKN and ARIH1, that function like function like RING-HECT hybrids. Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys-11'-linked polyubiquitination. Involved in the selective degradation of short-lived and abnormal proteins. Down-regulated during the S-phase it is involved in progression through the cell cycle. Regulates nuclear hormone receptors transcriptional activity. May play a role in myelopoiesis.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223806 | Ube2l3 (tGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2L 3 (Ube2l3), (10ug) |
USD 350.00 |
|
MR223806 | Ube2l3 (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2L 3 (Ube2l3) |
USD 150.00 |
|
MR223806L3 | Lenti ORF clone of Ube2l3 (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2L 3 (Ube2l3) |
USD 450.00 |
|
MR223806L4 | Lenti ORF clone of Ube2l3 (mGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2L 3 (Ube2l3) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review