Dynlt1b (NM_009342) Mouse Untagged Clone

CAT#: MC209505

Dynlt1b (untagged) - Mouse dynein light chain Tctex-type 1D (Dynlt1b), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dynlt1b
• Synonyms: AGS2; Dynlt1; Tctex-1; Tctex1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209505 representing NM_009342
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAGACTTCCAGGCCTCAGAGGAGACTGCATTTGTTGTTGATGAAGTGAGCAGCATTGTAAAGGAGG
  CTATAGAAAGCGCCATCGGTGGTAATGCCTACCAGCACAGCAAAGTCAACCAGTGGACCACTAATGTCCT
  AGAACAGACTTTGAGCCAACTCACCAAACTGGGGAGACCATTTAAATACATTGTGACCTGTGTGATCATG
  CAGAAGAACGGTGCTGGGTTACACTCCGCAAGTTCCTGCTTCTGGGACAGCTCCACAGACGGAAGCTGCA
  CAGTCCGATGGGAGAACAAGACCATGTACTGCATCGTCAGTACCTTCGGACTGTCCATCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009342
• Insert Size: 342 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_009342.2, NP_033368.1
• RefSeq Size: 791 bp
• RefSeq ORF: 342 bp
• Locus ID: 21648
• UniProt ID: P51807
• Cytogenetics: 17 3.97 cM
• Gene Summary: Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. Binds to transport cargos and is involved in apical cargo transport such as rhodopsin-bearing vesicles in polarized epithelia (By similarity). May also be a accessory component of axonemal dynein. Plays an important role in male germ cell development and function. Candidate for involvement in male sterility.[UniProtKB/Swiss-Prot Function]