Tcf7l2 (NM_001142924) Mouse Untagged Clone

CAT#: MC209499

Tcf7l2 (untagged) - Mouse transcription factor 7-like 2, T-cell specific, HMG-box (Tcf7l2), transcript variant 8, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tcf7l2
• Synonyms: Tcf-4; Tcf4; TCF4B; TCF4E
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209499 representing NM_001142924
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCGAACAAAGTACCGGTGGTGCAACACCCCCACCATGTCCACCCACTCACGCCTCTCATCACGTACA
  GCAATGAACACTTCACCCCGGGAAATCCACCTCCGCACTTACCAGCTGACGTAGACCCCAAAACAGGAAT
  CCCAAGGCCTCCGCACCCTCCAGATATCTCTCCATATTACCCGCTGTCGCCCGGCACCGTAGGACAAATC
  CCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCTGTGTACCCAATCACGACAGGAGGATTCA
  GACACCCCTACCCCACAGCGCTGACAGTCAACGCATCTATGTCTAGGTTCCCTCCCCATATGGTCCCTCC
  CCATCACACTCTGCACACGACCGGCATCCCTCACCCGGCCATCGTCACACCGACAGTCAAGCAGGAATCC
  TCCCAGAGTGACGTCGGCTCACTCCACAGCTCAAAGCATCAGGACTCCAAAAAGGAAGAAGAGAAGAAGA
  AGCCCCACATAAAGAAGCCCCTTAATGCATTCATGTTGTATATGAAAGAGATGAGAGCGAAGGTGGTGGC
  CGAATGCACATTGAAAGAGAGTGCAGCCATCAACCAGATTCTCGGGCGCAGGTGGCACGCCCTGTCCAGG
  GAAGAACAGGCAAAATACTACGAGCTGGCCCGGAAGGAACGACAGCTTCACATGCAGCTGTACCCTGGCT
  GGTCTGCACGGGATAACTATGGGAAGAAGAAGAAGAGAAAAAGAGACAAGCAGCCGGGGGAAACCAACGA
  ACACAGCGAATGTTTCCTAAATCCTTGCCTTTCGCTTCCTCCGATCACAGACCTGAGCGCTCCTAAGAAA
  TGCCGAGCGCGCTTTGGCCTTGATCAACAGAATAACTGGTGCGGCCCCTGCAGTCTTTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142924
• Insert Size: 900 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001142924.1, NP_001136396.1
• RefSeq Size: 3465 bp
• RefSeq ORF: 900 bp
• Locus ID: 21416
• UniProt ID: Q924A0
• Cytogenetics: 19 51.59 cM
• Gene Summary: Participates in the Wnt signaling pathway and modulates MYC expression by binding to its promoter in a sequence-specific manner. Acts as repressor in the absence of CTNNB1, and as activator in its presence. Activates transcription from promoters with several copies of the Tcf motif CCTTTGATC in the presence of CTNNB1. TLE1, TLE2, TLE3 and TLE4 repress transactivation mediated by TCF7L2/TCF4 and CTNNB1. Expression of dominant-negative mutants results in cell-cycle arrest in G1 (By similarity). Necessary for the maintenance of the epithelial stem-cell compartment of the small intestine.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (8) uses an alternate 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (8) has a substantially shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.