Tac2 (NM_009312) Mouse Untagged Clone
CAT#: MC209492
Tac2 (untagged) - Mouse tachykinin 2 (Tac2), transcript variant 1, (10ug)
"NM_009312" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tac2 |
Synonyms | PPT-B; Tac3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209492 representing NM_009312
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGAGCGCCATGCTGTTTGCGGCTGTCCTCGCCCTCAGCTTGGCTTGGACCTTCGGGGCTGTGTGTG AGGAGCCACAGGGGCAGGGAGGGAGGCTCAGTAAGGACTCTGATCTCTATCAGCTGCCTCCGTCCCTGCT TCGGAGACTCTACGACAGCCGCCCTGTCTCTCTGGAAGGATTGCTGAAAGTGCTGAGCAAGGCTAGCGTG GGACCAAAGGAGACATCACTTCCACAGAAACGTGACATGCACGACTTCTTTGTGGGACTTATGGGCAAGA GGAACAGCCAACCAGACACTCCCACCGACGTGGTTGAAGAGAACACCCCCAGCTTTGGCATCCTCAAATA A ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009312 |
Insert Size | 351 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_009312.2, NP_033338.2 |
RefSeq Size | 698 bp |
RefSeq ORF | 351 bp |
Locus ID | 21334 |
UniProt ID | P55099 |
Cytogenetics | 10 D3 |
Gene Summary | This gene encodes a member of the tachykinin family of signaling peptides that is widely expressed in the central nervous system and plays a role in diverse processes such as water homeostasis, pulmonary inflammation, cognition, fear memory consolidation and preeclampsia. The encoded protein is enzymatically processed to generate the mature neuropeptide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (1) represents the shorter transcript. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200495 | Tac2 (tGFP-tagged) - Mouse tachykinin 2 (Tac2) |
USD 350.00 |
|
MR200495 | Tac2 (Myc-DDK-tagged) - Mouse tachykinin 2 (Tac2), transcript variant 1 |
USD 150.00 |
|
MR200495L3 | Lenti ORF clone of Tac2 (Myc-DDK-tagged) - Mouse tachykinin 2 (Tac2), transcript variant 1 |
USD 450.00 |
|
MR200495L4 | Lenti ORF clone of Tac2 (mGFP-tagged) - Mouse tachykinin 2 (Tac2), transcript variant 1 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review