Meis1 (NM_001193271) Mouse Untagged Clone

CAT#: MC208957

Meis1 (untagged) - Mouse Meis homeobox 1 (Meis1), transcript variant B, (10ug)


  "NM_001193271" in other vectors (6)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Meis1 Antibody - N-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Meis1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Meis1
Synonyms C530044H18Rik; Evi8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208957 representing NM_001193271
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCAAAGGTACGACGACCTACCCCATTATGGGGGTATGGATGGAGTAGGCATCCCCTCCACGATGT
ATGGGGACCCGCATGCAGCCAGGTCCATGCAACCGGTCCACCACCTGAACCACGGGCCTCCTCTGCACTC
GCATCAGTACCCGCACACAGCTCACACCAACGCCATGGCCCCCAGCATGGGTTCCTCGGTCAATGACGCT
TTAAAGAGAGATAAAGATGCCATTTATGGACACCCCCTCTTCCCTCTCTTAGCACTGATTTTTGAGAAAT
GTGAATTAGCTACTTGTACCCCCCGCGAGCCGGGGGTGGCGGGCGGGGACGTCTGCTCGTCAGAGTCATT
CAATGAAGATATAGCGGTGTTCGCCAAACAGATTCGCGCAGAAAAACCTCTATTCTCTTCTAATCCAGAA
CTGGATAACTTGATGATTCAAGCCATACAAGTGTTAAGGTTTCATCTGTTGGAATTAGAGAAGGTACACG
AATTATGTGACAATTTCTGCCACCGGTATATTAGCTGTTTGAAAGGGAAAATGCCTATCGATTTGGTGAT
AGATGATAGAGAAGGAGGATCAAAATCAGACAGTGAAGATGTAACAAGATCAGCAAATCTAACTGACCAG
CCCTCTTGGAATAGAGACCATGATGACACGGCATCCACTCGTTCAGGAGGAACCCCGGGCCCTTCCAGCG
GTGGCCATACTTCACACAGTGGGGATAACAGCAGTGAGCAAGGTGATGGCTTGGACAACAGTGTAGCTTC
CCCCAGCACAGGTGACGATGATGACCCTGATAAGGACAAAAAGCGTCACAAAAAGCGTGGCATCTTTCCC
AAAGTAGCCACCAATATCATGAGGGCGTGGCTGTTCCAGCATCTAACACACCCTTACCCTTCTGAAGAAC
AGAAAAAGCAGTTGGCACAAGATACAGGACTTACCATCCTTCAAGTGAACAATTGGTTTATTAATGCCCG
GAGAAGAATAGTGCAGCCCATGATAGACCAGTCCAACCGAGCAGTCAGCCAAGGGACACCTTATAACCCT
GATGGACAGCCAATGGGAGGTTTTGTAATGGACGGTCAGCAGCACATGGGCATCAGAGCGCCAGGACCTA
TGAGTGGAATGGGCATGAATATGGGCATGGAGGGGCAGTGGCACTACATGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001193271
Insert Size 1173 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001193271.1, NP_001180200.1
RefSeq Size 3441 bp
RefSeq ORF 1173 bp
Locus ID 17268
UniProt ID Q60954
Cytogenetics 11 11.11 cM
Gene Summary Acts as a transcriptional regulator of PAX6. Also acts as a transcriptional activator of PF4 in complex with PBX1 or PBX2. Required for hematopoiesis, megakaryocyte lineage development and vascular patterning. May function as a cofactor for HOXA7 and HOXA9 in the induction of myeloid leukemias.[UniProtKB/Swiss-Prot Function]
Transcript Variant: : This variant (B) includes an alternate exon in the 3' coding region, which results in a frameshift, compared to variant A. The resulting protein (isoform B) has a shorter and distinct C-terminus, compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.