Fabp6 (NM_008375) Mouse Untagged Clone
CAT#: MC208789
Fabp6 (untagged) - Mouse fatty acid binding protein 6, ileal (gastrotropin) (Fabp6), (10ug)
"NM_008375" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fabp6 |
Synonyms | GT; I; I-1; I-15P; I-B; I-BABP; IL; ILBP; ILBP3; Illbp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208789 representing NM_008375
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCTTCAGTGGCAAATATGAATTTGAGAGTGAGAAGAATTACGATGAGTTCATGAAGCGCCTGGGTC TTCCAGGAGACGTGATTGAAAGGGGACGTAACTTCAAGATCATCACAGAGGTCCAGCAGGACGGACAGGA CTTCACCTGGTCCCAGTCTTACTCTGGGGGCAACATTATGAGCAACAAGTTCACCATTGGCAAAGAATGT GAAATGCAGACCATGGGGGGCAAGAAGTTCAAGGCTACCGTGAAGATGGAGGGTGGCAAGGTGGTGGCAG AGTTCCCCAACTATCACCAGACTTCGGAGGTCGTGGGTGACAAGTTGGTGGAGATCTCCACCATCGGGGA TGTGACCTATGAGCGCGTAAGCAAGAGGCTGGCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008375 |
Insert Size | 387 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008375.2, NP_032401.1 |
RefSeq Size | 510 bp |
RefSeq ORF | 387 bp |
Locus ID | 16204 |
UniProt ID | P51162 |
Cytogenetics | 11 25.81 cM |
Gene Summary | The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. This protein functions within the ileum, the distal 25-30% of the small intestine, and plays a role in enterohepatic circulation of bile acids and cholesterol homeostasis. In humans, it has been reported that polymorphisms in FABP6 confer a protective effect in obese individuals from developing type 2 diabetes. In mice deficiency of this gene affects bile acid metabolism in a gender-specific manner and was reported to be required for efficient apical to basolateral transport of conjugated bile acids. [provided by RefSeq, Jan 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215685 | Fabp6 (tGFP-tagged) - Mouse fatty acid binding protein 6 ileal (gastrotropin) (Fabp6), (10ug) |
USD 350.00 |
|
MR215685 | Fabp6 (Myc-DDK-tagged) - Mouse fatty acid binding protein 6, ileal (gastrotropin) (Fabp6) |
USD 150.00 |
|
MR215685L3 | Lenti ORF clone of Fabp6 (Myc-DDK-tagged) - Mouse fatty acid binding protein 6, ileal (gastrotropin) (Fabp6) |
USD 450.00 |
|
MR215685L4 | Lenti ORF clone of Fabp6 (mGFP-tagged) - Mouse fatty acid binding protein 6, ileal (gastrotropin) (Fabp6) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review