Hmga2 (NM_010441) Mouse Untagged Clone
CAT#: MC208667
Hmga2 (untagged) - Mouse high mobility group AT-hook 2 (Hmga2), (10ug)
"NM_010441" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Hmga2 |
Synonyms | 9430083A20Rik; HMGI-C; Hmgic; pg; pygmy |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208667 representing NM_010441
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCGCACGCGGTGAGGGCGCCGGGCAGCCGTCCACATCAGCCCAGGGACAACCTGCCGCCCCGGTGC CACAGAAGCGAGGACGCGGCCGACCCAGGAAGCAGCAGCAAGAGCCAACCTGTGAGCCCTCTCCTAAGAG ACCCAGAGGAAGACCCAAAGGCAGCAAAAACAAGAGCCCCTCTAAAGCAGCCCAGAAGAAAGCAGAGACC ATTGGAGAAAAACGGCCAAGAGGCAGACCTAGGAAATGGCCACAACAAGTCGTTCAGAAGAAGCCTGCTC AGGAGACTGAAGAGACATCCTCGCAAGAGTCCGCAGAGGAGGATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010441 |
Insert Size | 327 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_010441.2, NP_034571.1 |
RefSeq Size | 4226 bp |
RefSeq ORF | 327 bp |
Locus ID | 15364 |
UniProt ID | P52927 |
Cytogenetics | 10 67.94 cM |
Gene Summary | Functions as a transcriptional regulator. Functions in cell cycle regulation through CCNA2. Plays an important role in chromosome condensation during the meiotic G2/M transition of spermatocytes. Plays a role in postnatal myogenesis, is involved in satellite cell activation (PubMed:27446912).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the shorter isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221841 | Hmga2 (tGFP-tagged) - Mouse high mobility group AT-hook 2 (Hmga2), (10ug) |
USD 350.00 |
|
MR221841 | Hmga2 (Myc-DDK-tagged) - Mouse high mobility group AT-hook 2 (Hmga2) |
USD 150.00 |
|
MR221841L3 | Lenti ORF clone of Hmga2 (Myc-DDK-tagged) - Mouse high mobility group AT-hook 2 (Hmga2) |
USD 450.00 |
|
MR221841L4 | Lenti ORF clone of Hmga2 (mGFP-tagged) - Mouse high mobility group AT-hook 2 (Hmga2) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review