Gdnf (NM_010275) Mouse Untagged Clone
CAT#: MC208539
Gdnf (untagged) - Mouse glial cell line derived neurotrophic factor (Gdnf), (10ug)
"NM_010275" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Gdnf |
Synonyms | AI385739; ATF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208539 representing NM_010275
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGATTCGGGCCACTTGGAGTTAATGTCCAACTGGGGGTCTACGGAGACCGGATCCGAGGTGCCGCCG CCGGACGGGACTCTAAGATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGTTGCTCCACACCGCGTC TGCCTTCCCGCTGCCCGCCGGTAAGAGGCTTCTCGAAGCGCCCGCTGAAGACCACTCCCTCGGCCACCGC CGCGTGCCCTTCGCGCTGACCAGTGACTCCAATATGCCTGAAGATTATCCTGACCAGTTTGATGACGTCA TGGATTTTATTCAAGCCACCATTAAAAGACTGAAAAGGTCACCAGATAAACAAGCGGCAGCGCTTCCTCG AAGAGAGAGGAATCGGCAGGCTGCAGCTGCCAGCCCAGAGAATTCCAGAGGGAAAGGTCGCAGAGGCCAG AGGGGCAAAAATCGGGGGTGCGTTTTAACTGCCATACACTTAAATGTCACTGACTTGGGTTTGGGCTATG AAACCAAGGAGGAACTGATCTTTCGATATTGCAGCGGTTCCTGTGAATCGGCCGAGACAATGTATGACAA AATACTAAAAAACCTGTCTCGGAGTAGAAGGCTAACAAGTGACAAAGTAGGCCAGGCATGTTGCAGGCCG GTCGCCTTCGACGACGACCTGTCGTTTTTAGATGACAACCTGGTTTACCATATTCTAAGAAAGCATTCCG CTAAACGGTGTGGATGTATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_010275 |
Insert Size | 723 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC119031, AAI19032 |
RefSeq Size | 4477 bp |
RefSeq ORF | 723 bp |
Locus ID | 14573 |
UniProt ID | P48540 |
Cytogenetics | 15 A1 |
Gene Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Homozygous knockout mice for this gene exhibit defects in kidney development and neonatal death. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227554 | Gdnf (tGFP-tagged) - Mouse glial cell line derived neurotrophic factor (Gdnf), (10ug) |
USD 650.00 |
|
MR227554 | Gdnf (Myc-DDK-tagged) - Mouse glial cell line derived neurotrophic factor (Gdnf) |
USD 450.00 |
|
MR227554L3 | Lenti ORF clone of Gdnf (Myc-DDK-tagged) - Mouse glial cell line derived neurotrophic factor (Gdnf) |
USD 750.00 |
|
MR227554L4 | Lenti ORF clone of Gdnf (mGFP-tagged) - Mouse glial cell line derived neurotrophic factor (Gdnf) |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review