Egr3 (NM_018781) Mouse Untagged Clone
CAT#: MC208426
Egr3 (untagged) - Mouse early growth response 3 (Egr3), (10ug)
"NM_018781" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Egr3 |
Synonyms | Pilot |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208426 representing NM_018781
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-RsrII |
ACCN | NM_018781 |
Insert Size | 1164 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_018781.2, NP_061251.1 |
RefSeq Size | 1416 bp |
RefSeq ORF | 1164 bp |
Locus ID | 13655 |
UniProt ID | P43300 |
Cytogenetics | 14 D2 |
Gene Summary | Probable transcription factor involved in muscle spindle development.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222174 | Egr3 (tGFP-tagged) - Mouse early growth response 3 (Egr3), (10ug) |
USD 657.00 |
|
MR222174 | Egr3 (Myc-DDK-tagged) - Mouse early growth response 3 (Egr3) |
USD 457.00 |
|
MR222174L3 | Lenti ORF clone of Egr3 (Myc-DDK-tagged) - Mouse early growth response 3 (Egr3) |
USD 757.00 |
|
MR222174L4 | Lenti ORF clone of Egr3 (mGFP-tagged) - Mouse early growth response 3 (Egr3) |
USD 757.00 |
{0} Product Review(s)
Be the first one to submit a review