Poglut1 (NM_172380) Mouse Untagged Clone

CAT#: MC207891

Poglut1 (untagged) - Mouse protein O-glucosyltransferase 1 (Poglut1), (10ug)


  "NM_172380" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Poglut1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Poglut1
Synonyms 9630046K23Rik; Clp46; Ktelc; Ktelc1; Ru; Rumi; w; wsnp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207891 representing NM_172380
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCGTCGGGCGGGCTCTCGGCTTAGGGCATGGATGCTGTTACTGCTCCTGTGCCCGGTGCAGGGCC
GCCAGAAGGACTCAGGCTCAAAATGGAAAGTATTTCTTGACCAAATTAACAGGGCTTTGGAGAATTATGA
ACCATGTTCAAGTCAAAACTGCAGCTGCTATCACGGCGTCATAGAAGAGGACCTGACTCCTTTCCGAGGT
GGGATCTCCAGGAAGATGATGGCTGAGGTGGTCAGGCGGAAGCTAGGAACCCACTACCAGATCATTAAGA
ACCGGTTATTCAGGGAAGATGACTGCATGTTTCCCTCCAGGTGTAGTGGCGTGGAACACTTTATTTTGGA
AGTCATCCATCGCCTCCCTGACATGGAAATGGTAATCAATGTCCGAGATTATCCTCAGGTTCCTAAATGG
ATGGAGCCTACCATCCCCGTCTTCTCCTTCAGTAAGACATCGGAGTACCATGATATCATGTATCCTGCGT
GGACATTTTGGGAAGGGGGCCCTGCTGTGTGGCCACTTTATCCTACAGGTCTTGGACGGTGGGACCTCTT
CAGAGAAGACCTGTTAAGGTCAGCAGCGCAATGGCCGTGGGAAAAGAAAAATTCTACAGCATATTTCCGA
GGATCAAGGACAAGCCCAGAAAGAGATCCTCTCATTCTCCTATCTCGGAAAAATCCAAAGCTCGTCGATG
CCGAGTACACCAAAAACCAGGCCTGGAAGTCTATGAAAGATACTCTGGGAAAGCCAGCCGCTAAGGATGT
ACACCTCATAGATCACTGCAAATACAGATACCTATTTAATTTTCGAGGTGTAGCTGCAAGCTTCCGGTTC
AAACACCTCTTCTTGTGCGGTTCACTGGTCTTCCATGTTGGTGATGAGTGGGTGGAGTTCTTCTACCCAC
AACTAAAGCCATGGGTTCACTACATCCCAGTCAAGACCGACCTCTCCAATGTCCAGGAGCTGTTGCAGTT
TGTAAAAGCGAATGATGATATCGCTCAGGAAATTGCTAAAAGGGGAAGCCAGTTCATCATAAACCATTTG
CAGATGGATGACATCACCTGTTACTGGGAGAACCTCTTGACTGACTATTCCAAATTCCTGTCCTATAATG
TAACAAGAAGAAAAGATTATTATCAGATCGTTCCCAGACGTTTGAAAACTGAACTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_172380
Insert Size 1179 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172380.4, NP_759012.1
RefSeq Size 2835 bp
RefSeq ORF 1179 bp
Locus ID 224143
UniProt ID Q8BYB9
Cytogenetics 16 B4
Gene Summary This gene encodes a protein that can catalyze transfer of either UDP-glucose or UDP-xylose to epidermal growth factor (EGF) repeats, such as those found in Notch. Loss of this gene product results in embryonic lethality. Embryos have neural plate defects, heart defects, and truncations of their posterior axis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.