Golph3 (BC031445) Mouse Untagged Clone

CAT#: MC207095

Golph3 (untagged) - Mouse golgi phosphoprotein 3 (cDNA clone MGC:25472 IMAGE:4482612), (10ug)


  "BC031445" in other vectors (4)

Reconstitution Protocol

USD 165.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Golph3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Golph3
Synonyms 4733401N08Rik; 5730410D03Rik; AW413496
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC031445
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCTCGCTGACCCAGCGGAGCTCGGGCCTGGTGCAGCGGCGCACCGAGGCCTCCCGGAACGCTGCCG
ACAAGGAGCGGGCGGCGGGAGGCGGCGGCGGCAGCGGCGAGGACGAGGCGCAGAGCCGCCGCGACGAGCA
GGACGACGACGACAAGGGCGACTCCAAGGAAACGCGGCTGACCCTGATGGAGGAGGTGCTCCTGCTGGGC
CTCAAGGACCGAGAGGGTTACACATCATTTTGGAATGACTGTATATCATCTGGATTACGTGGCTGTATGT
TAATTGAATTAGCTTTGAGAGGAAGGTTACAGTTAGAGGCTTGTGGAATGAGAAGAAAAAGTCTTTTAAC
CAGAAAGGTGATCTGTAAATCGGATGCTCCAACAGGGGATGTTCTTCTTGATGAAGCTCTAAAGCATGTT
AAGGAGACTCAGCCTCCAGAGACAGTCCAGAACTGGATTGAGTTACTTAGTGGAGAGAACAGATACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC031445
Insert Size 489 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC031445, AAH31445
RefSeq Size 2861 bp
RefSeq ORF 488 bp
Locus ID 66629
Cytogenetics 15 A1
Gene Summary Phosphatidylinositol-4-phosphate-binding protein that links Golgi membranes to the cytoskeleton and may participate in the tensile force required for vesicle budding from the Golgi. Thereby, may play a role in Golgi membrane trafficking and could indirectly give its flattened shape to the Golgi apparatus. May also bind to the coatomer to regulate Golgi membrane trafficking. May play a role in anterograde transport from the Golgi to the plasma membrane and regulate secretion. Has also been involved in the control of the localization of Golgi enzymes through interaction with their cytoplasmic part. May play an indirect role in cell migration. Has also been involved in the modulation of mTOR signaling. May also be involved in the regulation of mitochondrial lipids biosynthesis (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.