Isca2 (BC022589) Mouse Untagged Clone
CAT#: MC206950
Isca2 (untagged) - Mouse iron-sulfur cluster assembly 2 homolog (S, (10ug)
"BC022589" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Isca2 |
Synonyms | 0710001C05Rik; 5730594E03Rik; Hbld1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206950 representing BC022589.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCCTCCAGGGCCTTGTCCCTAACTGCCGAGGCGGTCAGGGCTGTCATTCCTAGGCGCTCGGGA AGGCTTTTGACCCGCTGGGAAACAACATCTTCCATTCCAGAGGCTGGCGAGGGACAGATCCGCCTCACA GACAGCTGCGTCCAGGTAGGAGGTCGGACGCGGGGCGGCGGTGCCCAGGAGGGCTCTAGAAGACTTCCT AGTCACCCGTCCCGTTATCTCCGCTTGCTTGGCATTCTTGATCCTCTTTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | BC022589 |
Insert Size | 261 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC022589 |
RefSeq Size | 1614 bp |
RefSeq ORF | 260 bp |
Locus ID | 74316 |
Cytogenetics | 12 D1 |
MW | 9.2 kDa |
Gene Summary | Involved in the maturation of mitochondrial 4Fe-4S proteins functioning late in the iron-sulfur cluster assembly pathway. May be involved in the binding of an intermediate of Fe/S cluster assembly.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200187 | Isca2 (tGFP-tagged) - Mouse iron-sulfur cluster assembly 2 homolog (S |
USD 350.00 |
|
MR200187 | Isca2 (Myc-DDK-tagged) - Mouse iron-sulfur cluster assembly 2 homolog (S |
USD 150.00 |
|
MR200187L3 | Lenti ORF clone of Isca2 (Myc-DDK-tagged) - Mouse iron-sulfur cluster assembly 2 homolog (S |
USD 450.00 |
|
MR200187L4 | Lenti ORF clone of Isca2 (mGFP-tagged) - Mouse iron-sulfur cluster assembly 2 homolog (S |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review