Bok (BC030069) Mouse Untagged Clone

CAT#: MC206561

Bok (untagged) - Mouse Bcl-2-related ovarian killer protein (cDNA clone MGC:41110 IMAGE:2936938), (10ug)


Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
BOK Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Bok
Synonyms mtd, matador
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC030069
GCGGGTTTGAATGGAAGGGTCTAGACCGCCGGAGACGGCAGCGAGCGGGTCCTGAAACCAGAACTCCACC GCCGCCCCGCGCGCCATGAGGCGGGAGAGGTGTGGCGCCTCTCGCCCGCGCTTCGGCCATGGAGGTGCTG CGGCGCTCTTCTGTCTTTGCAGCGGAGATCATGGACGCCTTTGATCGCTCGCCCACAGACAAGGAGCTGG TGGCCCAGGCTAAGGCACTAGGCCGGGAGTACGTGCACGCGCGGCTTTTGCGCGCCGGCCTCTCCTGGAG CGCTCCAGAGCGTGCCTCGCCTGCCCCTGGAGGACGCTTGGCAGAGGTGTGCACAGTGCTGCTGCGCTTG GGAGATGAGCTGGAGCAGATCCGTCCCAGCGTATACCGGAACGTGGCCCGGCAGCTGCACATCCCCCTGC AGTCGGAGCCTGTGGTGACGGATGCCTTCCTGGCAGTGGCAGGCCACATCTTCTCAGCAGGTATCACATG GGGCAAGGTAGTGTCCCTGTATTCCGTGGCCGCGGGGCTAGCGGTGGACTGTGTCCGGCAGGCTCAGCCT GCCATGGTTCATGCCCTGGTTGACTGCCTGGGGGAATTTGTACGCAAGACCTTGGCTACCTGGCTTCGGA GGCGTGGCGGATGGACGGATGTCCTCAAGTGTGTGGTCAGCACAGATCCTGGCTTCCGCTCCCACTGGCT CGTGGCCACGCTCTGCAGCTTTGGCCGCTTCCTGAAGGCAGCATTCTTCCTGTTGTTGCCAGAGAGATGA GCTGGCCACCAGGGCAGGGGCCACTCCTAGGGTCCCTGGGCCCAATCCAAGGGGCCTCCAGTACCTACAA AGCACCTCCCTCACTCAAATTGGGAGCATTTAGCCCCTGGGGCCCTGTCCCAAACCCATTCCTTTGTGGA CCCTGGCCTCTGAGAGAGGAGTGTGGAGAAAGCCAGAGTCTGGAGCTGGCCTCTGTGACTGCTCTGGCTC TTCTCCTGGAACTCCTGCCAGAAAGTCAGGGTCGGTGTCCAGCCCTAGAGAAAGGGACCTGTGAATACTT TCACTCGATTTCCCAGGCCCCACCCAAGGAAGGGGCCTTCCCCAGACATGAGCTGGCCTCAGTCTTTGTG GAAAGCAGGTCCTGTACATTTGACCTGAAGGGGACTCTGGCTAATGCAGGAGAAGCCAGGGATGCAGAGT AAGAGAGCTTCTTGCTTAGGCTATTTCTAGATGAAGAAGGTATCCCTAAGCCACGATGGGTCCTTCATGG CAGGAACCAGAGAGGTAGGGCTCTAGGCTAGTTCACCTGACCAATGAACAAGAGATCCTGTGGATGAGGG GGTCTGTATAAGTTATACTCCAATAAAGCTTTACCTAGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAA
Restriction Sites EcoRI-NotI     
ACCN BC030069
Insert Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC030069, AAH30069
RefSeq Size 1403 bp
RefSeq ORF 642 bp
Locus ID 51800
Cytogenetics 1 D
Gene Summary Apoptosis regulator that functions through different apoptotic signaling pathways (PubMed:23429263, PubMed:26015568, PubMed:26949185, PubMed:27098698, PubMed:9535847). Plays a roles as pro-apoptotic protein that positively regulates intrinsic apoptotic process in a BAX- and BAK1-dependent manner or in a BAX- and BAK1-independent manner (PubMed:23429263, PubMed:26015568, PubMed:26949185). In response to endoplasmic reticulum stress promotes mitochondrial apoptosis through downstream BAX/BAK1 activation and positive regulation of PERK-mediated unfolded protein response (PubMed:26015568). Activates apoptosis independently of heterodimerization with survival-promoting BCL2 and BCL2L1 through induction of mitochondrial outer membrane permeabilization, in a BAX- and BAK1-independent manner, in response to inhibition of ERAD-proteasome degradation system, resulting in cytochrome c release (PubMed:9535847, PubMed:26949185). In response to DNA damage, mediates intrinsic apoptotic process in a TP53-dependent manner. Plays a role in granulosa cell apoptosis by CASP3 activation (By similarity). Plays a roles as anti-apoptotic protein during neuronal apoptotic process, by negatively regulating poly ADP-ribose polymerase-dependent cell death through regulation of neuronal calcium homeostasis and mitochondrial bioenergetics in response to NMDA excitation (PubMed:27098698). In addition to its role in apoptosis, may regulate trophoblast cell proliferation during the early stages of placental development, by acting on G1/S transition through regulation of CCNE1 expression.May also play a role as an inducer of autophagy by disrupting interaction between MCL1 and BECN1 (By similarity).[UniProtKB/Swiss-Prot Function]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.