Darc (BC005583) Mouse Untagged Clone
CAT#: MC206487
Darc (untagged) - Mouse Duffy blood group, chemokine receptor (cDNA clone MGC:11454 IMAGE:3968984), (10ug)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Frequently bought together (3)
Other products for "Darc"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Darc |
Synonyms | FY, GPD, CCBP1, CD234 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC005583
AGAGAAGTCATTAGCCCTGGGCACTTATCTTGGAGCCACAGCTGCTGACAGAGTCCAGGCCCTGTACTTC TCTGCCCTGAGCCTGCAGTGCCATGGGGAACTGTCTGTATCCGGTGGAAACCCTTTCACTAGACAAGAAT GGAACTCAGTTTACTTTCGACAGCTGGAATTATTCGTTTGAAGATAACTACTCCTATGAACTCTCGAGTG ACTACAGCCTGACACCAGCTGCTCCCTGCTACTCCTGTAATCTGCTTGACAGGTCTTCCCTGCCCTTCTT CATGCTCACCAGTGTCCTGGGCATGCTGGCAAGTGGCAGCATCCTCTTCGCGATTCTCAGACCTTTCTTC CACTGGCAGATTTGCCCCAGCTGGCCCATTCTGGCAGAGTTAGCAGTGGGCAGTGCCCTGTTCAGCATTG CAGTGCCCATCCTGGCACCAGGCTTACACAGCGCCCACAGCACAGCCCTATGCAACCTGGGCTACTGGGT ATGGTATACTTCTGCTTTTGCCCAAGCTCTGTTGATAGGATGCTATGCTTGCCTGAATCCCAGACTGAAT ATTGGTCAACTCCGTGGCTTCACCTTGGGACTCAGTGTGGGACTTTGGGGAGCAGCTGCCCTCTCAGGGC TGCCAGTCGCCCTGGCCAGTGATGTTTACAATGGCTTCTGCACCTTTCCATCCTCCAGAGACATGGAAGC TTTGAAGTACACTCATTATGCCATCTGTTTTACCATCTTCACTGTATTGCCACTGACTCTTTTGGCAGCC AAGGGGCTGAAGATAGCACTGAGCAAGGGGCCTGGCCCCTGGGTTAGTGTCTTGTGGATCTGGTTCATTT TCTGGTGGCCTCATGGGATGGTTCTCATATTTGATGCTTTGGTGAGGTCCAAAACTGTTCTTCTGTATAC ATGTCAATCCCAGAAGATTCTTGATGCGATGCTGAATGTGACAGAAGCCCTGAGTATGCTGCACTGTGTG GCTACCCCACTGCTCCTGGCCCTGTTCTGCCATCAGACCACCCGTAGATCCTTGTCCTCACTCTCCCTCC CTACAAGACAGGCTTCTCAAATGGATGCCCTTGCAGGCAAGTCCTAGTTTTGTTTTGTTTTTTCCCTACA TGTCAACTTAAATTAAAGTCTATACTGCTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | BC005583 |
Insert Size | 1005 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC005583, AAH05583 |
RefSeq Size | 1179 bp |
RefSeq ORF | 1005 bp |
Locus ID | 13349 |
Cytogenetics | 1 80.33 cM |
Gene Summary | Atypical chemokine receptor that controls chemokine levels and localization via high-affinity chemokine binding that is uncoupled from classic ligand-driven signal transduction cascades, resulting instead in chemokine sequestration, degradation, or transcytosis. Also known as interceptor (internalizing receptor) or chemokine-scavenging receptor or chemokine decoy receptor. Has a promiscuous chemokine-binding profile, interacting with inflammatory chemokines of both the CXC and the CC subfamilies but not with homeostatic chemokines. Acts as a receptor for chemokines including CCL2, CCL5, CCL7, CCL11, CCL13, CCL14, CCL17, CXCL5, CXCL6, IL8/CXCL8, CXCL11, GRO, RANTES, MCP-1 and TARC. May regulate chemokine bioavailability and, consequently, leukocyte recruitment through two distinct mechanisms: when expressed in endothelial cells, it sustains the abluminal to luminal transcytosis of tissue-derived chemokines and their subsequent presentation to circulating leukocytes; when expressed in erythrocytes, serves as blood reservoir of cognate chemokines but also as a chemokine sink, buffering potential surges in plasma chemokine levels (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.