Shfm1 (BC023490) Mouse Untagged Clone
CAT#: MC206294
Shfm1 (untagged) - Mouse split hand/foot malformation (ectrodactyly) type 1 (cDNA clone MGC:31011 IMAGE:5251089), (10ug)
Product Images
Frequently bought together (3)
Other products for "Shfm1"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Shfm1 |
Synonyms | DSS1; Shfdg1; Shfg |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC023490
GGAGTACTGAGGCTTCCGACTTTGCGGCCGGTCCGAGCAGCTTGGGTCTTGGCGCGGCGCGATGTCTGAA AAGAAGCAGCCGGTCGACTTGGGTCTCCTGGAAGAGGACGACGAGTTCGAGGAGTTTCCCGCGGAAGACT GGGCTGGCTTAGATGAAGATGAAGATGCACATGTCTGGGAGGATAATTGGGATGATGACAATGTAGAAGA TGACTTCTCTAACCAGTTACGTGCTGAGCTGGAGAAGCATGGCTACAAGATGGAGACATCATAGCATCTG GGAATGTCCCAGGAACCTCAATCATGGACTCTACCACAGTCTAGGACAGAGAAAGCAGGACGGGATACTT TAAAGAACATGTTTATTTCATTATCTGCTTCAATTTATTTTTGTTTTATAACAAAAAAAATAAGTAAATA AATGTTTTGATTTAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | BC023490 |
Insert Size | 213 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC023490, AAH23490 |
RefSeq Size | 449 bp |
RefSeq ORF | 213 bp |
Locus ID | 20422 |
Cytogenetics | 6 A1 |
Gene Summary | Component of the 26S proteasome, a multiprotein complex involved in the ATP-dependent degradation of ubiquitinated proteins. This complex plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins, which could impair cellular functions, and by removing proteins whose functions are no longer required. Therefore, the proteasome participates in numerous cellular processes, including cell cycle progression, apoptosis, or DNA damage repair. Component of the TREX-2 complex (transcription and export complex 2), composed of at least ENY2, GANP, PCID2, SEM1, and either centrin CETN2 or CETN3. The TREX-2 complex functions in docking export-competent ribonucleoprotein particles (mRNPs) to the nuclear entrance of the nuclear pore complex (nuclear basket). TREX-2 participates in mRNA export and accurate chromatin positioning in the nucleus by tethering genes to the nuclear periphery. Binds and stabilizes BRCA2 and is thus involved in the control of R-loop-associated DNA damage and thus transcription-associated genomic instability. R-loop accumulation increases in SEM1-depleted cells.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.