Cnmd (NM_010701) Mouse Untagged Clone

CAT#: MC205453

Lect1 (untagged) - Mouse leukocyte cell derived chemotaxin 1 (Lect1), (10ug)


  "NM_010701" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cnmd"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cnmd
Synonyms Bricd3; ChM-I; Chmd; Lect1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC045152
GGAACAGTTAGGACAGTGGGATAGGGTCTTCGCGTATCTTACTTCTCCATCTTCAGCCATGACAGAGAAC TCAGACAAAGTTCCTATCACCATGGTAGGGCCTGAGGACGTTGAGTTTTGCAGTCCCCCGGCGTACACCA CCGTCACCGTGAAGCCCTCCGGGAGCCCAACACGGCTGCTCAAGGTAGGAGCTGTGGTCCTCATTTCTGG CGCGGTACTGCTGCTCTTCGGGGCCATCGGGGCCTTCTACTTCTGGAAGGGGAATGACAATCACATTTAC AATGTTCATTACAGTATGAGTATCAATGGGAAACTACAAGATGGGTCAATGGAAATAGATGCTGTGAACA ACTTGGAGACCTTTAAAATGGGAAGCGGAGCGGAAGAAGCAATTGAAGTCAACGATTTTAAAAATGGCAT CACTGGGATCCGTTTTGCTGGAGGAGAGAAGTGCTACATCAAAGCACAGGTGAAGGCTCGCATCCCTGAG GTGGGCACAGTGACCAAGCAGAGCATCTCTGAACTGGAAGGCAAGATCATGCCAGCTAACTACGAAGAGA ACTCGCTGATTTGGGTGGCCGTGGACCAGCCTGTGAAGGACAGCAGCTTCTTGAGCTCTAAAATCCTTGA ACTCTGTGGCGACCTGCCGATTTTCTGGCTTAAGCCCATGTATCCAAAAGAAATCCAGAGAGAGAGAAGA GAAGTCGTGAGAAACAGTGCTCCCTCTACCACAAGAAGACCACACAGCGAACCTCGAGGTAACGCAGGCC CTGGAAGACTGAGTAACGGAACCAGACCCAATGTTCAGGACGACGCAGAACCTTTCAACCCTGACAATCC TTACCACCAGCAGGAAGGAGAAAGCATGACATTTGACCCTAGACTGGACCATGAAGGGATCTGCTGTATA GAATGCAGGCGGAGCTACACCCACTGCCAGAAGATCTGTGAACCACTGGGAGGCTACTATCCATGGCCTT ACAATTACCAAGGATGCCGCTCGGCCTGCAGAGTCGTCATGCCATGCAGCTGGTGGGTGGCCCGCATCTT GGGCATGGTGTAAATCCAGTTCATCTATCAGGACTGCCAAGCAAGAATCGATATGAGAGTTGAGAACCAA AGAAGCATAGAGCATGTCCATGCCAAGAGACCACAAAGTATTTTATATTCAACCTGAATAATGTTATCCT AAACGCTGTTGTGCACCACTGTGTGCAAATGTGCTGAAAGGGTAGTTTAACTCTACAATTATTATCATTT TACGACTTGCTTTACCAATAAAGCCTACTGCAAGTCTTTAAAAGCTACTTTTGAAATAAATATGAAAACT TAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_010701
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC045152, AAH45152
RefSeq Size 1347 bp
RefSeq ORF 1005 bp
Locus ID 16840
UniProt ID Q9Z1F6
Cytogenetics 14 D3
Gene Summary Bifunctional growth regulator that stimulates the growth of cultured chondrocytes in the presence of basic fibroblast growth factor (FGF) but inhibits the growth of cultured vascular endothelial cells. May contribute to the rapid growth of cartilage and vascular invasion prior to the replacement of cartilage by bone during endochondral bone development (By similarity). Inhibits in vitro tube formation and mobilization of endothelial cells (By similarity). Plays a role as antiangiogenic factor in cardiac valves to suppress neovascularization.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (2) has the same N- and C- termini, but is four amino acids shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.