Amelx (NM_001081978) Mouse Untagged Clone
CAT#: MC204837
Amelx (untagged) - Mouse amelogenin X chromosome (Amelx), transcript variant 1, (10ug)
"NM_001081978" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Amelx |
Synonyms | ALGN; Amel; Amg; AMGL; AMGX; LRAP; Rgsc888 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC059090
GAAACTCACTGAGCATACACTCAAAGAACCATCAAGAAATGGGGACCTGGATTTTGTTTGCCTGCCTCCT GGGAGCAGCTTTTGCTATGCCCCTACCACCTCATCCTGGAAGCCCTGGTTATATCAACTTAAGCTATGAG GTGCTTACCCCTTTGAAGTGGTACCAGAGCATGATAAGGCAGCCGTATCCTTCCTATGGTTACGAACCCA TGGGTGGATGGCTGCACCACCAAATCATCCCTGTGCTGTCTCAACAGCATCCCCCGAGTCACACCCTTCA GCCTCATCACCACCTTCCCGTGGTGCCAGCTCAACAGCCCGTGGCCCCCCAGCAACCAATGATGCCAGTT CCTGGCCACCACTCCATGACTCCAACCCAACACCATCAGCCAAACATCCCTCCATCCGCCCAGCAGCCCT TCCAGCAGCCCTTCCAGCCCCAGGCCATTCCACCCCAGTCTCATCAGCCCATGCAGCCCCAGTCACCTCT GCATCCCATGCAGCCCCTGGCACCACAGCCACCTCTGCCTCCACTGTTCTCCATGCAGCCCCTGTCCCCC ATTCTTCCTGAGCTGCCTCTGGAAGCTTGGCCAGCGACAGACAAGACCAAGCGGGAAGAAGTGGCGTTTT CTCCTATGAAGTGGTACCAGGGCATGACAAGGCATCCGCTTAACATGGAAAGCACAACAGAAAAATGATT CCAACCACTCTCCTACCTTCCCAGAACATAATGGCATGTAGTAGTGTTCAATATTGCCTTAATAAAATTC TCATCGGCTTAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_001081978 |
Insert Size | 660 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC059090, AAH59090 |
RefSeq Size | 798 bp |
RefSeq ORF | 660 bp |
Locus ID | 11704 |
UniProt ID | P63277 |
Cytogenetics | X 78.95 cM |
Gene Summary | Plays a role in the biomineralization of teeth. Seems to regulate the formation of crystallites during the secretory stage of tooth enamel development. Thought to play a major role in the structural organization and mineralization of developing enamel.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202481 | Amelx (tGFP-tagged) - Mouse amelogenin X chromosome (Amelx) |
USD 500.00 |
|
MR202481 | Amelx (Myc-DDK-tagged) - Mouse amelogenin X chromosome (Amelx), transcript variant 1 |
USD 300.00 |
|
MR202481L3 | Lenti ORF clone of Amelx (Myc-DDK-tagged) - Mouse amelogenin X chromosome (Amelx), transcript variant 1 |
USD 600.00 |
|
MR202481L4 | Lenti ORF clone of Amelx (mGFP-tagged) - Mouse amelogenin X chromosome (Amelx), transcript variant 1 |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review