Cbr1 (NM_007620) Mouse Untagged Clone

CAT#: MC204275

Cbr1 (untagged) - Mouse carbonyl reductase 1 (Cbr1), (10ug)


  "NM_007620" in other vectors (4)

Reconstitution Protocol

USD 450.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cbr1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cbr1
Synonyms AW261796; Cbr; CR
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC012714
CCACGCGTCCGCCCACGCGTCCGCTTGGTCTCCGACGGCCTCCCTTCTCACGCAGCCATGTCTTCCAGCA GACCCGTGGCGCTGGTGACCGGTGCTAACAAAGGAATCGGATTCGCGATCACTCGTGACCTGTGTCGGAA ATTCTCCGGGGACGTGGTGCTCGCGGCGCGGGACGAGGAGCGGGGCCAAACGGCAGTGCAAAAGCTGCAG GCGGAGGGCCTGAGCCCACGCTTCCACCAGCTGGACATCGACAACCCGCAGAGCATTCGCGCACTGCGCG ACTTTCTGCTCAAGGAATACGGAGGCCTGGACGTGCTGGTCAACAACGCAGGCATCGCCTTCAAGGTCAA TGACGACACCCCCTTCCACATTCAAGCAGAGGTGACAATGAAAACGAACTTTTTTGGTACCCGAGATGTC TGCAAGGAGCTGCTCCCTCTAATAAAACCCCAAGGCAGAGTGGTGAATGTGTCCAGCATGGTGAGTCTCA GGGCCCTGAAAAACTGCAGGCTGGAGCTGCAGCAGAAGTTTCGAAGCGAGACCATCACAGAGGAGGAGCT GGTGGGGCTCATGAACAAGTTTGTGGAAGATACAAAGAAAGGAGTCCATGCGGAAGAAGGTTGGCCTAAT AGTGCATATGGGGTCACCAAGATTGGGGTGACAGTCCTGTCCAGAATCCTTGCCAGGAAACTCAATGAGC AGAGGAGAGGGGACAAGATCCTTCTGAATGCCTGCTGCCCTGGGTGGGTCAGAACCGACATGGCAGGACC AAAAGCCACCAAAAGCCCAGAAGAAGGAGCAGAGACCCCTGTGTACTTGGCCCTTTTGCCTCCAGATGCA GAGGGGCCTCATGGGCAGTTTGTTCAAGATAAAAAAGTTGAACCATGGTGAACCCAACTCTCACCTCCCA CCCCCTTGTATCCAGACTTGCTGAAGGCCAAGGACATTTATAATGTAGTAACACTTCTGAAAAATAAACA TAGAATTCTTTGAATGCACAGAGGTTTAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007620
Insert Size 834 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC012714, AAH12714
RefSeq Size 1024 bp
RefSeq ORF 834 bp
Locus ID 12408
UniProt ID P48758
Cytogenetics 16 54.53 cM
Gene Summary NADPH-dependent reductase with broad substrate specificity. Catalyzes the reduction of a wide variety of carbonyl compounds including quinones, prostaglandins, menadione, plus various xenobiotics. Catalyzes the reduction of the antitumor anthracyclines doxorubicin and daunorubicin to the cardiotoxic compounds doxorubicinol and daunorubicinol. Can convert prostaglandin E2 to prostaglandin F2-alpha. Can bind glutathione, which explains its higher affinity for glutathione-conjugated substrates. Catalyzes the reduction of S-nitrosoglutathione (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.