Tomm7 (NM_025394) Mouse Untagged Clone
CAT#: MC203313
Tomm7 (untagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7), nuclear gene encoding mitochondrial protein, (10ug)
"NM_025394" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tomm7 |
Synonyms | 1110020J08Rik; AW047273; Tom7 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC055352
GGACACGGTGGTGGTTGTTGGGCTCCTCGTTCCGCTGGTCCGTCGTCGCCATGGTGAAGCTGAGCAAAGA AGCCAAACAGAGGCTGCAGCAGCTCTTCAAGGGCGGCCAGTTTGCCATCCGCTGGGGCTTTATTCCTCTC GTGATTTACCTGGGATTTACAAGGGGTGCAGATCCTGGAATGCCTGAACCGTCGGTTTTAAGCCTACTTT GGGGATAAAGGACTGTTTGAACATCTGGATTTGGACGCGATCCAACATGGAAGGTGTATACTCCAGCTGG ACAAGAAAGGAGACGTCATTTCAACGATTCTGTGGCAGAGTGGAGGAGCCTATACTGATTTATGATAGAC TATCAAAATAAATATTTTTAACAATGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025394 |
Insert Size | 168 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC055352, AAH55352 |
RefSeq Size | 447 bp |
RefSeq ORF | 168 bp |
Locus ID | 66169 |
UniProt ID | Q9D173 |
Cytogenetics | 5 A3 |
Gene Summary | Required for assembly and stability of the TOM complex (By similarity). Positive regulator of PRKN translocation to damaged mitochondria. Acts probably by stabilizing PINK1 on the outer membrane of depolarized mitochondria (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200023 | Tomm7 (tGFP-tagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7) |
USD 350.00 |
|
MR200023 | Tomm7 (Myc-DDK-tagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7), nuclear gene encoding mitochondrial protein |
USD 150.00 |
|
MR200023L3 | Lenti ORF clone of Tomm7 (Myc-DDK-tagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7), nuclear gene encoding mitochondrial protein |
USD 450.00 |
|
MR200023L4 | Lenti ORF clone of Tomm7 (mGFP-tagged) - Mouse translocase of outer mitochondrial membrane 7 homolog (yeast) (Tomm7), nuclear gene encoding mitochondrial protein |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review