Scg5 (NM_009162) Mouse Untagged Clone
CAT#: MC201568
Scg5 (untagged) - Mouse secretogranin V (Scg5), (10ug)
"NM_009162" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Scg5 |
Synonyms | 7B2; AI325031; Sgne-1; Sgne1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC029021 sequence for NM_009162
GTGACGCAGGAGCTATCCAGCACGTCAGCTCCCTGTTTTGGCCTAGATTGCAAGAAGCTCGCCCGCGGCC ACACGGTTAAAAATGGCCTCAAGGCTGGTCTCTGCTATGCTATCTGGCCTTTTGTTTTGGTTGATGTTTG AGTGGAATCCAGCATTCGCTTATAGTCCACGGACCCCTGACCGGGTCTCAGAGACAGACATCCAGAGGCT GCTTCATGGGGTTATGGAGCAGCTGGGCATTGCCAGGCCACGCGTGGAGTACCCGGCTCACCAGGCCATG AATCTTGTTGGGCCACAGAGCATCGAAGGGGGAGCTCACGAGGGTCTTCAGCATCTGGGTCCTTTTGGCA ACATCCCCAACATAGTGGCAGAGTTGACTGGTGACAACATTCCTAAGGACTTCAGTGAGGATCAAGGCTA CCCAGACCCTCCAAATCCCTGTCCTCTTGGGAAAACTGCTGATGATGGATGTCTAGAAAACGCCCCCGAC ACTGCAGAGTTCAGCCGAGAATTCCAGTTAGACCAGCACCTTTTTGATCCAGAACATGACTACCCAGGTT TGGGCAAGTGGAACAAGAAACTCCTTTATGAGAAAATGAAGGGAGGACAGAGGCGGAAGCGGAGGAGTGT CAATCCCTATCTACAAGGAAAGAGGTTGGACAATGTTGTGGCAAAGAAATCTGTCCCCCACTTCTCAGAA GAGGAGAAGGAAGCAGAATAAAGAGAAGACAGTATGTAGAAACCCATCCAATGCTTATGTGCATGTTCAT AGAGCCCGTGAGTGACAGCATGCATTTTACATATTTATGGATGAAAAGCAGCTGTCCTTGCCTCCATACC AATGCCTGTGCTTTCTGCTACATTAGAATAAAAGCTCCTTCTCTTTGGGGGATTTTTTTGATGTGGATCT GCAAGAAACATTACAATTAAAATGTATATGTCAAGTATAATAAAAACACGGATATGAAATACTCAGAAAA AAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009162 |
Insert Size | 639 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC029021, AAH29021 |
RefSeq Size | 1002 bp |
RefSeq ORF | 639 bp |
Locus ID | 20394 |
UniProt ID | P12961 |
Cytogenetics | 2 57.45 cM |
Gene Summary | Acts as a molecular chaperone for PCSK2/PC2, preventing its premature activation in the regulated secretory pathway. Binds to inactive PCSK2 in the endoplasmic reticulum and facilitates its transport from there to later compartments of the secretory pathway where it is proteolytically matured and activated. Also required for cleavage of PCSK2 but does not appear to be involved in its folding. Plays a role in regulating pituitary hormone secretion. The C-terminal peptide inhibits PCSK2 in vitro.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202313 | Scg5 (tGFP-tagged) - Mouse secretogranin V (Scg5) |
USD 650.00 |
|
MR202313 | Scg5 (Myc-DDK-tagged) - Mouse secretogranin V (Scg5) |
USD 450.00 |
|
MR202313L3 | Lenti ORF clone of Scg5 (Myc-DDK-tagged) - Mouse secretogranin V (Scg5) |
USD 750.00 |
|
MR202313L4 | Lenti ORF clone of Scg5 (mGFP-tagged) - Mouse secretogranin V (Scg5) |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review