Krtap13-1 (NM_183189) Mouse Untagged Clone

CAT#: MC201357

Krtap13 (untagged) - Mouse keratin associated protein 13-1 (Krtap13-1), (10ug)


  "NM_183189" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Krtap13-1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Krtap13-1
Synonyms AA589563; KAP13.1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027551 sequence for NM_183189
CTCTGCTCAACTTACACCTGCCATCAACATGTCCTACGGCTGCTATTCTGGAAACTTCTCTTCCCGCTCC AGTGGAGATCACCTGAGCTACCCTCACTCCTCTTGTGGCTCTTCCTACCCCAGTCACCTACTCCAGAGCA CTCGCTTCTACTCCCCAGGAACCTGCCATCTGGGCTCCTCTCTCCACAGTGGCTGTCAGCAGAACTGCTT CCAGCCCATCAGATGCCAGACTTCCCATGTGGTACACAGCTCCTGCCAGCGGCCCTGCTACAGCCCCAGA GTCTCCAGTGTCTGCAGTCCCTGCAGAACCACATATGCTGGCTCTCAGAGCTTTGGATCCAGCAGCTGCC ACTCTCAGGGTTATGGGTCTAGAAGCTCTTACTCTCTGAACTGTGGGTCCAGTGGCTTTAGACCACAAAG GGTCTCTTCTCTGGGCTATGGATCTGGATTCTGCCACCCATCCTATGTGCCCTATAGAACCTGTCAGTCT CCTTGCTACAGACCAAGCTGTGGCACTGGATCTGGATTCTATTGATCTTCTTTGTAACTTCCAGTCTTGT TGACCATTATCATCCTCCCCTGGTTCCCTGGCCTTTGTTGTCTTCCTTGGGCTGGGAAGAATTGTTCTCT CATTCCCTGATTGCCAATTCTTCACTTTCTCTCTAACCTCAGATATTGGCTGGTGGGTTTCCTTTGAGAA CTTTGTAATTAATCTCTTAACTCAAAAATAAAGCCTGCATTGCAAATGAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_183189
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC027551, AAH27551
RefSeq Size 766 bp
RefSeq ORF 507 bp
Locus ID 268905
Cytogenetics 16 C3.3

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.