Tsn (NM_011650) Mouse Untagged Clone
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tsn |
Synonyms | 2610034C24Rik; AU040286; C3PO; TB-RBP |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC004615 sequence for NM_011650
CCCACGCGTCCGGCGACGGCGACGGGCGTTGCGAGCGAGTCCGCTACTTGTTTGTGGGTCGTACTTCTTC GGCGGTGCTCCGGTGCTGACTGATTGTAGGGCAGCCAGCGCCATGTCTGTGAGCGAGATCTTCGTGGAGC TGCAGGGCTTTTTGGCTGCCGAGCAGGACATCCGAGAGGAAATACGAAAAGTTGTACAGAGTTTAGAACA AACTGCTCGAGAGATTTTGACCCTACTTCAAGGGGTCCACCAGGGTACTGGATTTCAGGACATTCCAAAG AGGTGCTTGAAAGCGAGAGAACATTTCAGTACAGTAAAAACACATCTCACATCCCTGAAGACCAAGTTCC CCGCTGAGCAGTATTACAGGTTTCATGAGCATTGGCGGTTCGTGCTTCAGCGCCTGGTCTTCCTGGCAGC ATTTGTGGTATATTTGGAAACAGAGACCCTGGTGACCCGAGAGGCTGTTACAGAGATTCTTGGCATTGAA CCAGATCGGGAAAAAGGGTTTCATCTGGATGTGGAAGATTATCTCTCAGGAGTTTTAATTCTTGCCAGTG AACTGTCGAGGCTGTCTGTCAACAGTGTCACTGCTGGAGACTACTCTCGGCCCCTTCACATTTCTACTTT CATCAATGAGCTGGATTCTGGTTTTCGTCTTCTCAATCTGAAAAATGACTCCCTGAGGAAGCGCTACGAC GGCTTGAAGTACGATGTGAAGAAAGTAGAGGAGGTGGTCTATGACCTTTCCATCCGAGGCTTCAATAAGG AGACAGCAGCGGCTTGTGGTGAAAAATAGGAGCTTTTCCCTGGGGCTGGCCTTGCTGGCGCTGCAGTTGC CAGGGAGGGCTAGCTCAGTGCCTCTTCCTGTAGTTAGCACACCAGTTGCTAAACACTGCGCTTTATTTTC GTAACCAGCTGTGTGCTGTGAGTGTCAGAATTGAAATACTTTTTGGATCTAAACAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011650 |
Insert Size | 687 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC004615, AAH04615 |
RefSeq Size | 979 bp |
RefSeq ORF | 687 bp |
Locus ID | 22099 |
UniProt ID | Q62348 |
Cytogenetics | 1 E2.3 |
Gene Summary | DNA-binding protein that specifically recognizes consensus sequences at the breakpoint junctions in chromosomal translocations, mostly involving immunoglobulin (Ig)/T-cell receptor gene segments. Seems to recognize single-stranded DNA ends generated by staggered breaks occurring at recombination hot spots.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer, protein-coding variant. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202740 | Tsn (tGFP-tagged) - Mouse translin (Tsn) |
USD 500.00 |
|
MR202740 | Tsn (Myc-DDK-tagged) - Mouse translin (Tsn) |
USD 300.00 |
|
MR202740L3 | Lenti ORF clone of Tsn (Myc-DDK-tagged) - Mouse translin (Tsn) |
USD 600.00 |
|
MR202740L4 | Lenti ORF clone of Tsn (mGFP-tagged) - Mouse translin (Tsn) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review