Integrin alpha 5 (ITGA5) (NM_002205) Human 3' UTR Clone

CAT#: SC212067

3' UTR clone of integrin alpha 5 (fibronectin receptor alpha polypeptide) (ITGA5) for miRNA target validation


Reconstitution Protocol

USD 683.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "Integrin alpha 5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol Integrin alpha 5
Synonyms CD49e; FNRA; VLA-5; VLA5A
ACCN NM_002205
Insert Size 1028 bp
Sequence Data
>SC212067 3' UTR clone of NM_002205
The sequence shown below is from the reference sequence of NM_002205. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCCAGCCACCTCTGATGCCTGAGTCCTCCCAATTTCAGACTCCCATTCCTGAAGAACCAGTCCCCCCAC
CCTCATTCTACTGAAAAGGAGGGGTCTGGGTACTTCTTGAAGGTGCTGACGGCCAGGGAGAAGCTCCTCT
CCCCAGCCCAGAGACATACTTGAAGGGCCAGAGCCAGGGGGGTGAGGAGCTGGGGATCCCTCCCCCCCAT
GCACTGTGAAGGACCCTTGTTTACACATACCCTCTTCATGGATGGGGGAACTCAGATCCAGGGACAGAGG
CCCCAGCCTCCCTGAAGCCTTTGCATTTTGGAGAGTTTCCTGAAACAACTTGGAAAGATAACTAGGAAAT
CCATTCACAGTTCTTTGGGCCAGACATGCCACAAGGACTTCCTGTCCAGCTCCAACCTGCAAAGATCTGT
CCTCAGCCTTGCCAGAGATCCAAAAGAAGCCCCCAGCTAAGAACCTGGAACTTGGGGAGTTAAGACCTGG
CAGCTCTGGACAGCCCCACCCTGGTGGGCCAACAAAGAACACTAACTATGCATGGTGCCCCAGGACCAGC
TCAGGACAGATGCCACACAAGGATAGATGCTGGCCCAGGGCCCAGAGCCCAGCTCCAAGGGGAATCAGAA
CTCAAATGGGGCCAGATCCAGCCTGGGGTCTGGAGTTGATCTGGAACCCAGACTCAGACATTGGCACCTA
ATCCAGGCAGATCCAGGACTATATTTGGGCCTGCTCCAGACCTGATCCTGGAGGCCCAGTTCACCCTGAT
TTAGGAGAAGCCAGGAATTTCCCAGGACCCTGAAGGGGCCATGATGGCAACAGATCTGGAACCTCAGCCT
GGCCAGACACAGGCCCTCCCTGTTCCCCAGAGAAAGGGGAGCCCACTGTCCTGGGCCTGCAGAATTTGGG
TTCTGCCTGCCAGCTGCACTGATGCTGCCCCTCATCTCTCTGCCCAACCCTTCCCTCACCTTGGCACCAG
ACACCCAGGACTTATTTAAACTCTGTTGCAAGTGCAATAAATCTGACC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002205.2
Summary The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha subunit and a beta subunit that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 5 subunit. This subunit associates with the beta 1 subunit to form a fibronectin receptor. This integrin may promote tumor invasion, and higher expression of this gene may be correlated with shorter survival time in lung cancer patients. Note that the integrin alpha 5 and integrin alpha V subunits are encoded by distinct genes. [provided by RefSeq, Oct 2015]
Locus ID 3678

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.