LAGE3 (NM_006014) Human 3' UTR Clone

CAT#: SC212024

3' UTR clone of L antigen family member 3 (LAGE3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LAGE3
• Synonyms: CVG5; DXS9879E; DXS9951E; ESO3; GAMOS2; ITBA2; Pcc1
• ACCN: NM_006014
• Insert Size: 199 bp
• Sequence Data:
  Insert Sequence

  >SC212024 3’UTR clone of NM_006014
  The sequence shown below is from the reference sequence of NM_006014. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CAGCGCTTTGGGCCCCCCGTTTCCCGCTAAGCCTGGCCTGGGCAAATGGAGCGAGGTCCCACTTTGCGT
  CTCCTTGTAGGCAGTGCGTCCATCCTTCCCTAGGGCAGGAATTCCCACAGTTGCTACTTTCCTGGGAGG
  GCCTCATGTTTTATCTGGTTCTTAAATGTTTGTTACTACAGAAAATAAAACTGCGCTACTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006014.5
• Summary: This gene belongs to the ESO/LAGE gene family, members of which are clustered together on chromosome Xq28, and have similar exon-intron structures. Unlike the other family members which are normally expressed only in testis and activated in a wide range of human tumors, this gene is ubiquitously expressed in somatic tissues. The latter, combined with the finding that it is highly conserved in mouse and rat, suggests that the encoded protein is functionally important. An intronless pseudogene with high sequence similarity to this gene is located on chromosome 9. [provided by RefSeq, Jul 2008]
• Locus ID: 8270
• MW: 7.5