B4GALT3 (B4GALT2) (NM_001005417) Human 3' UTR Clone

CAT#: SC209406

3' UTR clone of UDP-Gal:betaGlcNAc beta 14- galactosyltransferase polypeptide 2 (B4GALT2) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: B4GALT2
• Synonyms: B4Gal-T2; B4Gal-T3; beta4Gal-T2
• ACCN: NM_001005417
• Insert Size: 758 bp
• Sequence Data:
  Insert Sequence

  >SC209406 3’UTR clone of NM_001005417
  The sequence shown below is from the reference sequence of NM_001005417. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CGGCCTCCGTCGTGGCCCCCTCGGGGCTGACACTAATGGACAGAGGCTCTCGGTGCCGAAGATTGCCTG
  CCAGAGGACTGACCACAGCCTGGCTGGCAGCTGCTCTGTGGAGGACCTCCAGGACTGAGACTGGGCTCT
  GTTTTCCAAGGGTCTTCACTAGGCCCCCTAGCTACACCTGGAAGTTTCAGAACCCACTTTGGGGGGCCT
  CCTGCCTGGGCAGGCTCTTCAAGTGTGGCCCTCTTTGGAGTCAACCCTCCTTCCCGACCCCCTCCCCCT
  AGCCCAGCCCCAGTCACTGTCAGGGTCGGGCCAGCCCCTGCACTGCCTCGCAGAGTGGCCTGGGCTAGG
  TCACTCCACCTCTCTGTGCCTCAGTTTCCCCCCCTTGAGTCCCCTAGGGCCTGGAAGGGTGGGAGGTAT
  GTCTAGGGGGCAGTGTCTCTTCCAGGGGGAATTCTCAGCTCTTGGGAACCCCCTTGCTCCCAGGGGAGG
  GGAAACCTTTTTCATTCAACATTGTAGGGGGCAAGCTTTGGTGCGCCCCCTGCTGAGGAGCAGCCCCAG
  GAGGGGACCAGAGGGGATGCTGTGTCGCTGCCTGGGATCTTGGGGTTGGCCTTTGCATGGGAGGCAGGT
  GGGGCTTGGATCAGTAAGTCTGGTTCCCGCCTCCCTGTCTGAGAGAGGAGGCAGGAGCCCCAGGGCCGG
  CTTGTGTTTGTACATTGCACAGAAACTTGTGTGGGTGCTTTAGTAAAAAACGTGAATGGAGCAAAAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001005417.2
• Summary: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene synthesizes N-acetyllactosamine in glycolipids and glycoproteins. Its substrate specificity is affected by alpha-lactalbumin but it is not expressed in lactating mammary tissue. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
• Locus ID: 8704
• MW: 26.4