Peregrin (BRPF1) (NM_004634) Human 3' UTR Clone

CAT#: SC208663

3' UTR clone of bromodomain and PHD finger containing 1 (BRPF1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "BRPF1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol BRPF1
Synonyms BR140; IDDDFP
ACCN NM_004634
Insert Size 696 bp
Sequence Data
>SC208663 3’UTR clone of NM_004634
The sequence shown below is from the reference sequence of NM_004634. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGAGCAGTGAGACCAGCGATAGTGATTGATACTGCTCAACACAGCCCAACCTATAGTGCCCTGTGACT
TCTCTCCTCCCCTTTGCTCACTGTCCTGGAGTGGCACCGGCCTCTGCACTGACTCATTTCTGGTCTTGG
GGCCAGTCTCAGGGGAAGCTGGGTGGGGGAGGTCCCTCCTGCCCTAAGTGCAGCTGGACTGTACAGAAC
ACTCCAAGGGCCAATGGCAGTTCAGCGCAAGGAGAGGGAGGGCCCACAGGTCAGAAAAAGCTCCAGAGA
CCTCACAGCATTGTAGGGCGGGGTGGTGGGCCAAAGTTAGGACACTGCGTAAAACAGGCCATCCCACCA
CCTCTACCTGCTCATGCCAGGAGAATCCATAACTGCCTAGAGGCCTGGGGCCCCTACCGGTCGTGAGGT
GAGTGGGCATCTGTCCAGCCTGGAAGAGGGGCACTAGGTGACTCCCTCCCCTGCTGTTGTAAATACTGT
AATTATCGGAGAATTTAAATTATTCTCATTTGTAACTGCGTTTCCGGGTCGCGCCAGAGTCATTTGGTA
CTAAAAAAAAAAAAAAAAAAGACTGGGGGCTGTCCCCATTTCCCTTCTCTTTCCCATAGATTCCCCCAC
CTTTCAAACTGGTTTGTATTTATTTCAAAGGAAGAAAATATATTGATTCTTAGAAAATAAACTGTCAAT
TTAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004634.3
Summary This gene encodes a bromodomain, PHD finger and chromo/Tudor-related Pro-Trp-Trp-Pro (PWWP) domain containing protein. The encoded protein is a component of the MOZ/MORF histone acetyltransferase complexes which function as a transcriptional regulators. This protein binds to the catalytic MYST domains of the MOZ and MORF proteins and may play a role in stimulating acetyltransferase and transcriptional activity of the complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Locus ID 7862
MW 25.2

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.