p19 INK4d (CDKN2D) (NM_001800) Human 3' UTR Clone

CAT#: SC208109

3' UTR clone of cyclin-dependent kinase inhibitor 2D (p19 inhibits CDK4) (CDKN2D) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CDKN2D
• Synonyms: INK4D; p19; p19-INK4D
• ACCN: NM_001800
• Insert Size: 628 bp
• Sequence Data:
  Insert Sequence

  >SC208109 3’UTR clone of NM_001800
  The sequence shown below is from the reference sequence of NM_001800. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CTGCAGGGCCACATGGTGGCCCCGCTGTGATCTGGGGTCACCCTCTCCAGCAAGAGAACCCCGTGGGGT
  TATGTATCAGAAGAGAGGGGAAGAAACACTTTCTCTTCTTGTTTCTCCTGCCCACTGCTGCAGTAGGGG
  AGGAGCACAGTTTGTGGCTTATAGGTGTTGGTTTTGGGGGTGTGAGTGTTTGGGGGACGTTTCTCATTT
  GTTTTTCTCACTCCTTTTGGTGTGTTGGACAGAGAAGGGCTCCTGCAGGCCACAGCCACCTAAACGGTT
  CAGTTTCTTCTGCGCCTCAGGCTGCTGGGGCCTCAGACGAGACCCAAGGGCAGAGCATTTAAGAGTGAA
  GTCATGACCTCCAGGGAGCCTAGAAGCTGGTGGCCTTGGCCGGCTGTGCTCAGAGACCTGAAGTGTGCA
  CGTTGCTTCAGGCATGGGGGGTGGGGGGAGCGTCCCAAATCAATAAGAAGGTAGAATGAGTTATGAGTT
  ATTCATATTCTGTTGGAAGCTTGTTTTCCAGTCTCTTGTACAGCGTTTTAAAAGAAATGGATTCTATTT
  ATTATGCTTTATTGGAAAAAATGTTGTAATAATTTAATGTTTTTACCCATTAAATTAAGACTTGTGCAT
  GATCACA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001800.4
• Summary: The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to form a stable complex with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. The abundance of the transcript of this gene was found to oscillate in a cell-cycle dependent manner with the lowest expression at mid G1 and a maximal expression during S phase. The negative regulation of the cell cycle involved in this protein was shown to participate in repressing neuronal proliferation, as well as spermatogenesis. Two alternatively spliced variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]
• Locus ID: 1032
• MW: 23.9