IL1 beta (IL1B) (NM_000576) Human 3' UTR Clone

CAT#: SC207948

3' UTR clone of interleukin 1 beta (IL1B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL1 beta
• Synonyms: IL-1; IL1-BETA; IL1beta; IL1F2
• ACCN: NM_000576
• Insert Size: 640 bp
• Sequence Data:
  Insert Sequence

  >SC207948 3’UTR clone of NM_000576
  The sequence shown below is from the reference sequence of NM_000576. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GACTTCACCATGCAATTTGTGTCTTCCTAAAGAGAGCTGTACCCAGAGAGTCCTGTGCTGAATGTGGAC
  TCAATCCCTAGGGCTGGCAGAAAGGGAACAGAAAGGTTTTTGAGTACGGCTATAGCCTGGACTTTCCTG
  TTGTCTACACCAATGCCCAACTGCCTGCCTTAGGGTAGTGCTAAGAGGATCTCCTGTCCATCAGCCAGG
  ACAGTCAGCTCTCTCCTTTCAGGGCCAATCCCCAGCCCTTTTGTTGAGCCAGGCCTCTCTCACCTCTCC
  TACTCACTTAAAGCCCGCCTGACAGAAACCACGGCCACATTTGGTTCTAAGAAACCCTCTGTCATTCGC
  TCCCACATTCTGATGAGCAACCGCTTCCCTATTTATTTATTTATTTGTTTGTTTGTTTTATTCATTGGT
  CTAATTTATTCAAAGGGGGCAAGAAGTAGCAGTGTCTGTAAAAGAGCCTAGTTTTTAATAGCTATGGAA
  TCAATTCAATTTGGACTGGTGTGCTCTCTTTAAATCAAGTCCTTTAATTAAGACTGAAAATATATAAGC
  TCAGATTATTTAAATGGGAATATTTATAAATGAGCAAATATCATACTGTTCAATGGTTCTGAAATAAAC
  TTCACTGAAGAAAAAAAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000576.3
• Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. The induction of cyclooxygenase-2 (PTGS2/COX2) by this cytokine in the central nervous system (CNS) is found to contribute to inflammatory pain hypersensitivity. Similarly, IL-1B has been implicated in human osteoarthritis pathogenesis. Patients with severe Coronavirus Disease 2019 (COVID-19) present elevated levels of pro-inflammatory cytokines such as IL-1B in bronchial alveolar lavage fluid samples. The lung damage induced by the Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is to a large extent, a result of the inflammatory response promoted by cytokines such as IL-1B. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, Jul 2020]
• Locus ID: 3553
• MW: 23.7