Histone H3.3C (H3F3C) (NM_001013699) Human 3' UTR Clone

CAT#: SC207812

3' UTR clone of H3 histone family 3C (H3F3C) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: H3-5
• Synonyms: H3.5; H3F3C
• ACCN: NM_001013699
• Insert Size: 604 bp
• Sequence Data:
  Insert Sequence

  >SC207812 3’UTR clone of NM_001013699
  The sequence shown below is from the reference sequence of NM_001013699. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GCTCGCCGGATACGGGGAGAGAGAGCTTAAGTGAAGGCAGTTTTTATGGCATTTTGTAGTAAATTCTGT
  AAAATACTTTGGTTTAATTGGTGACTTTTTTTGTAAGAAATTGTTTATATGTTGCATTTGTACTTAAGT
  CATTCCATCTTTCACTCAGGATGAATGCGAAAAGTGACTGTTTACAGACCTCAGTGATGTCAGCACTGT
  TGCTCAGGAGTGACAAGTTGTTAATATGCAAAACGGATGCGTGATATTTCTTGCTTCTCATGATGCATG
  TTTCTGTATGTTAATGACTTGTTGGGTAGCTATTAAGGTACTAGAATTGATAAATGTGTACAACAGGGT
  CCTTTTGCAATAAAACTGGTTATGACTTGATCCAAGTGTTTAACAATTGGGGCTGTTAAGTCTGACCAT
  ACATCACTGTGATAGAATGTAGGCTTTTTCAAGGGTGAAGATACAAACCTTAACCACAGTGTAACTTAT
  AGTTTCCTTTAAAAAAAAAAAATTAAACCTGGCAGCTATAGAATACAATATGTGCATTTATAATAGCTA
  TTTTATATATTGTAGTGTCAACATTTTCAAATTAAATGTTTTACATTCACAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001013699.3
• Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded by this gene is a replication-independent histone that is a member of the histone H3 family. [provided by RefSeq, Oct 2015]
• Locus ID: 440093
• MW: 23.4