MYO3A (NM_017433) Human 3' UTR Clone

CAT#: SC207788

3' UTR clone of myosin IIIA (MYO3A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MYO3A
• Synonyms: DFNB30
• ACCN: NM_017433
• Insert Size: 599 bp
• Sequence Data:
  Insert Sequence

  >SC207788 3’UTR clone of NM_017433
  The sequence shown below is from the reference sequence of NM_017433. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CAGCGCCGGCGCCTCGTCCAGCAGTCCTAACCGTTCAACGAGGCAGTCACCGCCGTCGGAAGGCGCTGG
  AGCCTGCGGGGCAGCAGGGGCCAAGCAGGCACTCTGGGGCTGGCACCAGCAGGCACTGAAGCTGCGGCC
  CTGATCTCCGCAGAGGCTGCCTGCTGCGCTCGGCCCTCAAGTGCCCGGGCCGGCCTTCGTGCTCCGAAA
  CAAGAGACCTGGGAGCCCTCGGGAAACCTCCCCCGACGCTCTCTCTCGGAACTCCCGCACCCTCCTTTC
  TCACCAGCCCGCCAGTTGTGGCAACCCTGTCCTTGTTCCCCTAATCTATCACTTTGTTCTTTTTTTTTG
  TGACTCCTGTGGACTCCACTGCGCCTGGGATCTCGCCAACCCCTCTCTCATTTGGGGTGACTGAATTCA
  CAGATTTTTTTTTTTATTGGAAACGGCTTTTCTTGGCCAACAGAACACTTGCTAGCGGTTGAATCTTAG
  AGAAAAAAGCCCGGGAGGGGTGGGGAGAATTTCGAAGATGTATTTCATCTCAAGCTTGCTCTTTCTCTT
  CCTTTGGTTATTAAGGTCACTAAATAAAGGAAGTGCCTTGGAAAACC
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_017433.5
• Summary: The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
• Locus ID: 53904
• MW: 21.9