MBD4 (NM_003925) Human 3' UTR Clone

CAT#: SC207386

3' UTR clone of methyl-CpG binding domain protein 4 (MBD4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MBD4
• Synonyms: MED1
• ACCN: NM_003925
• Insert Size: 584 bp
• Sequence Data:
  Insert Sequence

  >SC207386 3’UTR clone of NM_003925
  The sequence shown below is from the reference sequence of NM_003925. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GAAAATCATGAAAAATTAAGTCTATCTTAAACTCTGCAGCTTTCAAGCTCATCTGTTATGCATAGCTTT
  GCACTTCAAAAAAGCTTAATTAAGTACAACCAACCACCTTTCCAGCCATAGAGATTTTAATTAGCCCAA
  CTAGAAGCCTAGTGTGTGTGCTTTCTTAATGTGTGTGCCAATGGTGGATCTTTGCTACTGAATGTGTTT
  GAACATGTTTTGAGATTTTTTTAAAATAAATTATTATTTGACAACAATCCAAAAAAAATACGGCTTTTC
  CAATGATGAAATATAATCAGAAGATGAAAAATAGTTCTAAACTATCAATAATACAAAGCAAATTTCTAT
  CAGCCTTGCTAAAGCTAGGGGCCCACTAAATATTTTTATCGGCTAGGCGTGGTGGTGCATGCCTGTAAT
  CTCGGAAGGCTGAGGCAGGAGGATCATTTGAGCTCATGAGGGCCCAGGAGGTCAAGGCTTCAGTGAGCC
  ATGATCATGCCACTGCACTCCAGTCTGGATGACAGAGAGAGACCCTGTCTCAAAAAATATATATTTAAA
  AAATAAAAATAAAAGCTGACCCCAAAGACAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003925.3
• Summary: The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
• Locus ID: 8930
• MW: 22.7