C1GALT1C1 (NM_001011551) Human 3' UTR Clone

CAT#: SC207337

3' UTR clone of C1GALT1-specific chaperone 1 (C1GALT1C1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C1GALT1C1
• Synonyms: C1GALT2; C38H2-L1; COSMC; HSPC067; MST143; TNPS
• ACCN: NM_001011551
• Insert Size: 566 bp
• Sequence Data:
  Insert Sequence

  >SC207337 3’UTR clone of NM_001011551
  The sequence shown below is from the reference sequence of NM_001011551. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TTACCTCCAAATGGTTCTGACAATGACTGAGAAGTGGTAGAAAAGCGTGAATATGATCTTTGTATAGGA
  CGTGTGTTGTCATTATTTGTAGTAGTAACTACATATCCAATACAGCTGTATGTTTCTTTTTCTTTTCTA
  ATTTGGTGGCACTGGTATAACCACACATTAAAGTCAGTAGTACATTTTTAAATGAGGGTGGTTTTTTTC
  TTTAAAACACATGAACATTGTAAATGTGTTGGAAAGAAGTGTTTTAAGAATAATAATTTTGCAAATAAA
  CTATTAATAAATATTATATGTGATAAATTCTAAATTATGAACATTAGAAATCTGTGGGGCACATATTTT
  TGCTGATTGGTTAAAAAATTTTAACAGGTCTTTAGCGTTCTAAGATATGCAAATGATATCTCTAGTTGT
  GAATTTGTGATTAAAGTAAAACTTTTAGCTGTGTGTTCCCTTTACTTCTAATACTGATTTATGTTCTAA
  GCCTCCCCAAGTTCCAATGGATTTGCCTTCTCAAAATGTACAACTAAGCAACTAAAGAAAATTAAAGTG
  AAAGTTGAAAAATA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001011551.3
• Summary: This gene encodes a type II transmembrane protein that is similar to the core 1 beta1,3-galactosyltransferase 1, which catalyzes the synthesis of the core-1 structure, also known as Thomsen-Friedenreich antigen, on O-linked glycans. This gene product lacks the galactosyltransferase activity itself, but instead acts as a molecular chaperone required for the folding, stability and full activity of the core 1 beta1,3-galactosyltransferase 1. Mutations in this gene have been associated with Tn syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2009]
• Locus ID: 29071
• MW: 22.2