NKG2A (KLRC1) (NM_213657) Human 3' UTR Clone

CAT#: SC207083

3' UTR clone of killer cell lectin-like receptor subfamily C member 1 (KLRC1) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KLRC1
• Synonyms: CD159A; NKG2; NKG2A
• ACCN: NM_213657
• Insert Size: 557 bp
• Sequence Data:
  Insert Sequence

  >SC207083 3’UTR clone of NM_213657
  The sequence shown below is from the reference sequence of NM_213657. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  ATAATATATCATTGTAAGCATAAGCTTTAGAGGTAAAGCGTTTGCATTTGCAGTGCATCAGATAAATTG
  TATATTTCTTAAAATAGAAATATATTATGATTGCATAAATCTTAAAATGAATTATGTTATTTGCTCTAA
  TAAGAAAATTCTAAATCAATTATTGAAACAGGATACACACAATTACTAAAGTACAGACATCCTAGCATT
  TGTGTCGGGCTCATTTTGCTCAACATGGTATTTGTGGTTTTCAGCCTTTCTAAAAGTTGCATGTTATGT
  GAGTCAGCTTATAGGAAGTACCAAGAACAGTCAAACCCATGGAGACAGAAAGTAGAATAGTGGTTGCCA
  ATGTCTGAGGGAGGTTGAAATAGGAGATGACCTCTAACTGATAGAACGTTACTTTGTGTCGTGATGAAA
  ACTTTCTAAATTTCAGTAGTGGTGATGGTTGTAACTCTGCGAATATACTAAACATCATTGATTTTTAAT
  CATTTTAAGTGCATGAAATGTATGCTTTGTACACGACACTTCAATAAAGCTATCCAGAAAAAAAAAAAA
  AAAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_213657.2
• Summary: Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor family, also called NKG2 family, which is a group of transmembrane proteins preferentially expressed in NK cells. This family of proteins is characterized by the type II membrane orientation and the presence of a C-type lectin domain. This protein forms a complex with another family member, KLRD1/CD94, and has been implicated in the recognition of the MHC class I HLA-E molecules in NK cells. The genes of NKG2 family members form a killer cell lectin-like receptor gene cluster on chromosome 12. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jan 2015]
• Locus ID: 3821
• MW: 21.7