CACNG6 (NM_031897) Human 3' UTR Clone

CAT#: SC206908

3' UTR clone of calcium channel voltage-dependent gamma subunit 6 (CACNG6) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CACNG6
• ACCN: NM_031897
• Insert Size: 507 bp
• Sequence Data:
  Insert Sequence

  >SC206908 3’UTR clone of NM_031897
  The sequence shown below is from the reference sequence of NM_031897. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TGTCCCAAGCGGGGGCACCGGGCCACCTAGAGCCACGCGTGAGACTTCTCTAAGCAACCACCGAGCCCT
  TTGACCTTCTCCATTGTACCCCCAAGATCTTTTTGCCCCATCTCCTAGAGAAACTGTGTTCTCCCTGCT
  CGGGGGCCCATGTTTTTTTACACGCCTGCCTCCTGTCCCCTTATCCTTTCTCCCTCTGTAAATACGTTT
  TTCTCTGTGGCTGTATGTGGGTTGCTTGGGGGTGGGATGGGAAGAGGCTCTTTGCAAACGAGGGTCCCC
  AGAGAAGACTGGCGGGGACCTGATGGGGTAGCTGGGGTGTGGGGTTGGGGGATGAGGTCAGGGGGTCTT
  GGGTGGGAGTTGGGGGCCCCTTCATTTCCCAGGTCTGGATCGATTCACTTGCCGGGAGAGACTTTTTAC
  AACTCATCTGCAGCTCCGGGTGCGGTTGGGGGAGATAGCGAAGGGTCTGGCCTCGCTGTGATCTGATTT
  GGGATTAAAGGTTTGGAAATTTAA
  AGCGGACCGACTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCC
  CAACCTGCCATCACGAGATTTCGATTCCACCGCCGC
  
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_031897.3
• Summary: Voltage-dependent calcium channels are composed of five subunits. The protein encoded by this gene represents one of these subunits, gamma, and is one of two known gamma subunit proteins. This particular gamma subunit is an integral membrane protein that is thought to stabilize the calcium channel in an inactive (closed) state. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members that function as transmembrane AMPA receptor regulatory proteins (TARPs). Alternative splicing results in multiple transcript variants. Variants in this gene have been associated with aspirin-intolerant asthma. [provided by RefSeq, Dec 2010]
• Locus ID: 59285
• MW: 17.6