HSPA2 (NM_021979) Human 3' UTR Clone

CAT#: SC206748

3' UTR clone of heat shock 70kDa protein 2 (HSPA2) for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "HSPA2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HSPA2
Synonyms HSP70-2; HSP70-3
ACCN NM_021979
Insert Size 498 bp
Sequence Data
>SC206748 3’UTR clone of NM_021979
The sequence shown below is from the reference sequence of NM_021979. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGGGACCCACCATCGAAGAAGTGGACTAAGCTTGCACTCAAGTCAGCGTAAACCTCTTTGCCTTTCTC
TCTCTCTCTTTTTTTTTGTTTGTTTCTTTGAAATGTCCTTGTGCCAAGTACGAGATCTATTGTTGGAAG
TCTTTGGTATATGCAAATGAAAGGAGAGGTGCAACAACTTAGTTTAATTATAAAAGTTCCAAAGTTTGT
TTTTTAAAAACATTATTCGAGGTTTCTCTTTAATGCATTTTGCGTGTTTGCTGACTTGAGCATTTTTGA
TTAGTTCGTGCATGGAGATTTGTTTGAGATGAGAAACCTTAAGTTTGCACACCTGTTCTGTAGAAGCTT
GGAAACAGTAAAATATATAGGAGCTTAAATTGTTTATTTTTATGTACTACTTTAAAACTAAACTGAACA
TTGCAGTAATGTTAAGGACAGGTATACTTTTTGCAAACAAATGCATAAATGCAAATGTAAAGTAAAGCT
GAAATTGATCTCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_021979.4
Summary Molecular chaperone implicated in a wide variety of cellular processes, including protection of the proteome from stress, folding and transport of newly synthesized polypeptides, activation of proteolysis of misfolded proteins and the formation and dissociation of protein complexes. Plays a pivotal role in the protein quality control system, ensuring the correct folding of proteins, the re-folding of misfolded proteins and controlling the targeting of proteins for subsequent degradation. This is achieved through cycles of ATP binding, ATP hydrolysis and ADP release, mediated by co-chaperones. The affinity for polypeptides is regulated by its nucleotide bound state. In the ATP-bound form, it has a low affinity for substrate proteins. However, upon hydrolysis of the ATP to ADP, it undergoes a conformational change that increases its affinity for substrate proteins. It goes through repeated cycles of ATP hydrolysis and nucleotide exchange, which permits cycles of substrate binding and release (PubMed:26865365). Plays a role in spermatogenesis. In association with SHCBP1L may participate in the maintenance of spindle integrity during meiosis in male germ cells (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 3306
MW 19.1

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.