PTGER3 (NM_198717) Human 3' UTR Clone

CAT#: SC206582

3' UTR clone of prostaglandin E receptor 3 (subtype EP3) (PTGER3) transcript variant 7 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PTGER3
• Synonyms: EP3; EP3-I; EP3-II; EP3-III; EP3-IV; EP3-VI; EP3e; lnc003875; PGE2-R
• ACCN: NM_198717
• Insert Size: 511 bp
• Sequence Data:
  Insert Sequence

  >SC206582 3’UTR clone of NM_198717
  The sequence shown below is from the reference sequence of NM_198717. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TTTTGCCAGGAGGAATTTTGGGGAAATTAAAACCTGCCTTTCTGCCAGGATCACATCACTGGAAGCTCC
  ATGACTCTCTTTTTGTAAAAGAAAAAAAAATCACAGAAACACCCACCTCCCAAACTATTCTCTTTTACT
  TCTTCCCCCAAGCCCACCCCCAAATATAACTGTTATCCAGAAGCTGTTATGTCCTGTTTCCATACATGT
  TTTTGTACTTTTACTATATCTACATACATCAATTAAACTTATGTCCTATTGTTTTGTGAATTTATATTT
  GCGTATACATTATCATATGTAAAATTTGCATTTTTTTATTGAAAATTATGTTTCTTGAGATTTATCCAC
  ATTGAAACATGGAGCTCTAAATCGTTAATTTTAACCGCTATAGAGTATTCCATAATTTGAATAAAGCAT
  AATTTGTTTGTACAATCTCCCGCCAAGGGAAAATTATTTCCACACTCATCATGACAAGGAGCACTGCAA
  AAATAAAAATAAAAATTACATTCATACA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_198717.2
• Summary: The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor may have many biological functions, which involve digestion, nervous system, kidney reabsorption, and uterine contraction activities. Studies of the mouse counterpart suggest that this receptor may also mediate adrenocorticotropic hormone response as well as fever generation in response to exogenous and endogenous stimuli. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
• Locus ID: 5733
• MW: 19.9