CYP3A7 (NM_000765) Human 3' UTR Clone

CAT#: SC206499

3' UTR clone of cytochrome P450 family 3 subfamily A polypeptide 7 (CYP3A7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYP3A7
• Synonyms: CP37; CYPIIIA7; P-450(HFL33); P-450111A7; P450-HFLA; P450HLp2
• ACCN: NM_000765
• Insert Size: 494 bp
• Sequence Data:
  Insert Sequence

  >SC206499 3’UTR clone of NM_000765
  The sequence shown below is from the reference sequence of NM_000765. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TCAAGGGATGAGACCGTAAGTGGAGCCTGATTTCCCTAAGGACTTCTGGTTTGCTCTTTAAGAAAGCTG
  TGCCCCAGAACACCAGAGACCTCAAATTACTTTACAAATAGAACCCTGAAATGAAGACGGGCTTCATCC
  AATGTGCTGCATAAATAATCAGGGATTCTGTACGTGCATTGTGCTCTCTCATGGTCTGTATAGAGTGTT
  ATACTTGGTAATATAGAGGAGATGACCAAATCAGTGCTGGGGAAGTAGATTTGGCTTCTCTGCTTCTCA
  TAGGACTATCTCCACCACCCCCAGTTAGCACCATTAACTCCTCCTGAGCTCTGATAACATAATTAACAT
  TTCTCAATAATTTCAACCACAATCATTAATAAAAATAGGAATTATTTTGATGGCTCTAACAGTGACATT
  TATATCATGTGTTATATCTGTAGTATTCTATAGTAAGCTTTATATTAAGCAAATCAATAAAAACCTCTT
  TACAAAAGTAT
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000765.5
• Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes, which participate in drug metabolism and the synthesis of cholesterol, steroids and other lipids. This enzyme hydroxylates testosterone and dehydroepiandrosterone 3-sulphate, which is involved in the formation of estriol during pregnancy. This gene is part of a cluster of related genes on chromosome 7q21.1. Naturally-occurring readthrough transcription occurs between this gene and the downstream CYP3A51P pseudogene and is represented by GeneID:100861540. [provided by RefSeq, Jan 2015]
• Locus ID: 1551
• MW: 18.6