VNN2 (NM_078488) Human 3' UTR Clone

CAT#: SC206209

3' UTR clone of vanin 2 (VNN2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VNN2
• Synonyms: FOAP-4; GPI-80
• ACCN: NM_078488
• Insert Size: 460 bp
• Sequence Data:
  Insert Sequence

  >SC206209 3’UTR clone of NM_078488
  The sequence shown below is from the reference sequence of NM_078488. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  ATAGCTTTGCAAAATATTGTAATGTTATAGGGCGTCTCTTTATCACTCAGCTTCTGCATCATATGCTTG
  GCTGAATGTGTTTATCGGCTTCCCAAGTTTACTAAGAAACTTTGAAGGGCTATTTCAGTAGTATAGACC
  AGTGAGTCCTAAATATTTTTTCTCATCAATAATTATTTTTTAAGTATTATGATAATGTTGTCCATTTTT
  TTGGCTACTCTGAAATGTTGCAGTGTGGAACAATGGAAAGAGCCTGGGTGTTTGGGTCAGATAAATGAA
  GATCAAACTCCAGCTCCAGCCTCATTTGCTTGAGACTTTGTGTGTATGGGGGACTTGTATGTATGGGAG
  TGAGGAGTTTCAGGGCCATTGCAAACATAGCTGTGCCCTTGAAGAGAATAGTAATGATGGGAATTTAGA
  GGTTTATGACTGAATTCCCTTTGACATTAAAGACTATTTGAATTCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_078488.3
• Summary: This gene product is a member of the Vanin family of proteins that share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. The encoded protein is a GPI-anchored cell surface molecule that plays a role in transendothelial migration of neutrophils. This gene lies in close proximity to, and in same transcriptional orientation as two other vanin genes on chromosome 6q23-q24. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
• Locus ID: 8875
• MW: 17.4