NMDAR2C (GRIN2C) (NM_000835) Human 3' UTR Clone

CAT#: SC205926

3' UTR clone of glutamate receptor ionotropic N-methyl D-aspartate 2C (GRIN2C) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GRIN2C
• Synonyms: GluN2C; NMDAR2C; NR2C
• ACCN: NM_000835
• Insert Size: 442 bp
• Sequence Data:
  Insert Sequence

  >SC205926 3’UTR clone of NM_000835
  The sequence shown below is from the reference sequence of NM_000835. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CGGATCTCCAGTCTGGAGTCAGAAGTGTGAGTTATCAGCCACTCAGGCTCCGAGCCAGCTGGATTCTCT
  GCCTGCCACTGTCAGGGTTAAGCGGCAGGCAGGATTGGGCTTTTCTGGCTTCTGCCATGAAATCCTGGC
  CATGGGACCCCAGTGACAGATGATGTCTTCCATGGTCATCAGTGACCTCAGTAGCCTCAAATCATGGTG
  AGGGCTGGGCTTTTGCTGTCCTCTTCTCACGCAGAGTTCTGCCAGGAGGGTGTGCTGTGGGGGTCAGAC
  TCCTGAGGCTCTCCCTTCCCTGGGGCTAGCCAGTTACTGGTCATGGCTGCTGTGGGCATGGAGGCTGGA
  ACTTGTGGTTGAGGCAGGGCCATCCCGATCCTTGCTCTACCTGGCTAGAGTTTCTTCTCATCAGAGCAC
  TGGGACATTAAACCAACCTTTTACAACA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000835.6
• Summary: This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
• Locus ID: 2905
• MW: 15.5