PSG2 (NM_031246) Human 3' UTR Clone

CAT#: SC205840

3' UTR clone of pregnancy specific beta-1-glycoprotein 2 (PSG2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PSG2
• Synonyms: CEA; PSBG2; PSG1
• ACCN: NM_031246
• Insert Size: 463 bp
• Sequence Data:
  Insert Sequence

  >SC205840 3’UTR clone of NM_031246
  The sequence shown below is from the reference sequence of NM_031246. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GGACTTCTTCCTCTCCTTAATCCAACATAGCAGCTGTGATGTCATTTCTGTATTTCAGGAAGACTGGCA
  GGAGATTTATGGAAAGGTCTCTTACAAGGACTCTTGAATACAAGCTCCTGATAACTTCAAGATCATACC
  ACTGGACTAAGAACTTTCAAAATTTTAATGAACAGGCTGATACCTTCATGAAATTCAAGACAAAGAAGA
  AAAATACTCAATGTTATTGGACTAAATAATCAAAAGGATAATGATTTCATAATTTTCTATTTGAAAATG
  TGCTGATTCTTGGAATGTTTCATTCTCCAGATTTATGAACATTTTTTCTTGAGCAATTGGTAAAGTATA
  CTTTTGTAAACAAAAATTGAAACATTTCCTTTTGCTCTCTATCTGAGTGCCCCAGAATTGGGAATCTAT
  TCATGAGTATTCATATGTTTATGGTAATAAAGCTATTTGCACAAGTTCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_031246.4
• Summary: The human pregnancy-specific glycoproteins (PSGs) are a family of proteins that are synthesized in large amounts by placental trophoblasts and released into the maternal circulation during pregnancy. Molecular cloning and analysis of several PSG genes has indicated that the PSGs form a subgroup of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily of genes. Members of the CEA family consist of a single N domain, with structural similarity to the immunoglobulin variable domains, followed by a variable number of immunoglobulin constant-like A and/or B domains. Most PSGs have an arg-gly-asp (RGD) motif, which has been shown to function as an adhesion recognition signal for several integrins, in the N-terminal domain (summary by Teglund et al., 1994 [PubMed 7851896]). For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]
• Locus ID: 5670
• MW: 18