IL5RA (NM_175724) Human 3' UTR Clone

CAT#: SC205451

3' UTR clone of interleukin 5 receptor alpha (IL5RA) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "IL5RA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol IL5RA
Synonyms CD125; CDw125; HSIL5R3; IL5R
ACCN NM_175724
Insert Size 420 bp
Sequence Data
>SC205451 3' UTR clone of NM_175724
The sequence shown below is from the reference sequence of NM_175724. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGTGAGTGGAGCCAACCTATTTATGTGGGTAAGTAGCTTATGTTTATTTTACATTGGCAGCCTTCCTTGT
GATCAAAAAAGGTAATCCCAGAAACGTACCCGTTCACTCGTGGGTCTTAAAATGGTTTCATATCTCTATT
GTGACTAATTTTCTCTCGGTCTACTGCCTTTTCAATCAGGAATAGATTTGCCATGAAGCCAGTGAAGTTT
TTAAGTGTCTAGGCTTCTCATTAGCGCCAACTCTCCTAGACCTGGTGCCTGTTTTTTTTCCAAGTTTTGT
TTCTACTTCTATCCATTTTTTAAATTAAACTTTTTATTTTGAAATAATTATCACACTCACAAGCTGTGGG
AAGAAATAATAGAGATCCTGTGTCTCTTTCATCCAGTTTTCCTCAAGGGTAACATCTTACAAAACTATAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_175724.2
Summary The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]
Locus ID 3568

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.