MUS81 (NM_025128) Human 3' UTR Clone

CAT#: SC205339

3' UTR clone of MUS81 endonuclease homolog (S. cerevisiae) (MUS81) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MUS81
• Synonyms: SLX3
• ACCN: NM_025128
• Insert Size: 417 bp
• Sequence Data:
  Insert Sequence

  >SC205339 3’UTR clone of NM_025128
  The sequence shown below is from the reference sequence of NM_025128. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CTCTACTGCAGCTACGGCCCCTTGACCTGAGCTTATGCCGTGAAACAGCCCCCAGCCCCCGTCTGTCCC
  CCAACCCAGGCTAGCCAGCCTTTTAACAACATCTTTTGGGGTACAATTAGAATCTAAGTGTTTGCAGCC
  ATATGTGTCATGTAGAAGATGCCTAGCCCTGGGGACCTTGTGAAATACGCAGGAACCAGGGATACCATC
  TGGTCCAGTGGTTTTTAAACAAAGCTGCTTAGCACCTGGAATTCCCTGGTCAGGGAGATGGAGTCAGTG
  GGGCATTGCAGCTTGGAATCTATTTTATGTCACCAGTTGGTCCTCATCAAATAAAATTTCCTTAGGAGT
  GCAGAGGGCTCATTGGGAAAATAAAAATAATAAAAATAAATAAAACTTCCTAAAAGAAAAGATTGAAAA
  CCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_025128.5
• Summary: This gene encodes a structure-specific endonuclease which belongs to the XPF/MUS81 endonuclease family and plays a critical role in the resolution of recombination intermediates during DNA repair after inter-strand cross-links, replication fork collapse, and DNA double-strand breaks. The encoded protein associates with one of two closely related essential meiotic endonuclease proteins (EME1 or EME2) to form a complex that processes DNA secondary structures. It contains an N-terminal DEAH helicase domain, an excision repair cross complementation group 4 (ERCC4) endonuclease domain, and two tandem C-terminal helix-hairpin-helix domains. Mice with a homozygous knockout of the orthologous gene have significant meiotic defects including the failure to repair a subset of DNA double strand breaks. [provided by RefSeq, Jun 2017]
• Locus ID: 80198
• MW: 15.5