HES1 (NM_005524) Human 3' UTR Clone

CAT#: SC205270

3' UTR clone of hairy and enhancer of split 1 (Drosophila) (HES1) for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "HES1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HES1
Synonyms bHLHb39; HES-1; HHL; HRY
ACCN NM_005524
Insert Size 529 bp
Sequence Data
>SC205270 3’UTR clone of NM_005524
The sequence shown below is from the reference sequence of NM_005524. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACTCCATGTGGAGGCCGTGGCGGAACTGAGGGGGCTCAGGCCACCCCTCCTCCTAAACTCCCCAACCC
ACCTCTCTTCCCTCCGGACTCTAAACAGGAACTTGAATACTGGGAGAGAAGAGGACTTTTTTGATTAAG
TGGTTACTTTGTGTTTTTTTAATTTCTAAGAAGTTACTTTTTGTAGAGAGAGCTGTATTAAGTGACTGA
CCATGCACTATATTTGTATATATTTTATATGTTCATATTGGATTGCGCCTTTGTATTATAAAAGCTCAG
ATGACATTTCGTTTTTTACACGAGATTTCTTTTTTATGTGATGCCAAAGATGTTTGAAAATGCTCTTAA
AATATCTTCCTTTGGGGAAGTTTATTTGAGAAAATATAATAAAAGAAAAAAGTAAAGGCTTTTATGTCT
TCGAACTGATTCTTCCAGAATATGTAAAAAGGCTTTTGGTGGAATTTGAATTACATGTAATTGGTAATT
CAGGAATTGACTCTTTTGTTATTAAAAGAACATTTGTAAAAATCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005524.4
Summary This protein belongs to the basic helix-loop-helix family of transcription factors. It is a transcriptional repressor of genes that require a bHLH protein for their transcription. The protein has a particular type of basic domain that contains a helix interrupting protein that binds to the N-box rather than the canonical E-box. [provided by RefSeq, Jul 2008]
Locus ID 3280
MW 20.5

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.