RFX4 (NM_002920) Human 3' UTR Clone

CAT#: SC205260

3' UTR clone of regulatory factor X 4 (influences HLA class II expression) (RFX4) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "RFX4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RFX4
Synonyms NYD-SP10
ACCN NM_002920
Insert Size 421 bp
Sequence Data
>SC205260 3’UTR clone of NM_002920
The sequence shown below is from the reference sequence of NM_002920. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATGGAAAGTCCTTCAAAAACTTTGGGTAGTTAATGTTTGAAGAAAGGGCTTTCTGCCAGCCTGGGCAA
CATAGTGAGACTTCATTTCCACACACACAAAAAGCCAGACATCTTGGCTCACACCTGTAGTCCCAGCTA
CTTGGGAGGCTGAGGTGGGAGAATTGCTTGAGCCCAGGAGCTACGATCGCACCACTGCATTCTAGCCTT
AGTGATACAGTGAGACCTTGTCTCAAAAAAAGAAAAACAGGGCTTTCTGGAAAAACATTCTTCTCCCAC
AATCTCCAAAAGATAATGCCAAAACCTGGGTATCTTCCTGGATTTGTGAATGACGTACAGGTATTCATT
TATTCATTGGTACACATTCTGTATGCTGCTGTTTTCAAGTTGGCAAATTAAGCATATGATAAAATCCCA
AAACTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002920.3
Summary This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
Locus ID 5992
MW 15.8

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.