Glypican 3 (GPC3) (NM_001164618) Human 3' UTR Clone

CAT#: SC205249

3' UTR clone of glypican 3 (GPC3) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GPC3
• Synonyms: DGSX; GTR2-2; MXR7; OCI-5; SDYS; SGB; SGBS; SGBS1
• ACCN: NM_001164618
• Insert Size: 409 bp
• Sequence Data:
  Insert Sequence

  >SC205249 3’UTR clone of NM_001164618
  The sequence shown below is from the reference sequence of NM_001164618. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GTGGTGTGCTTCTTCTTCCTGGTGCACTGACTGCCTGGTGCCCAGCACATGTGCTGCCCTACAGCACCC
  TGTGGTCTTCCTCGATAAAGGGAACCACTTTCTTATTTTTTTCTATTTTTTTTTTTTTGTTATCCTGTA
  TACCTCCTCCAGCCATGAAGTAGAGGACTAACCATGTGTTATGTTTTCGAAAATCAAATGGTATCTTTT
  GGAGGAAGATACATTTTAGTGGTAGCATATAGATTGTCCTTTTGCAAAGAAAGAAAAAAAACCATCAAG
  TTGTGCCAAATTATTCTCCTATGTTTGGCTGCTAGAACATGGTTACCATGTCTTTCTCTCTCACTCCCT
  CCCTTTCTATCGTTCTCTCTTTGCATGGATTTCTTTGAAAAAAAATAAATTGCTCAAATAAAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001164618.2
• Summary: Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. The protein encoded by this gene can bind to and inhibit the dipeptidyl peptidase activity of CD26, and it can induce apoptosis in certain cell types. Deletion mutations in this gene are associated with Simpson-Golabi-Behmel syndrome, also known as Simpson dysmorphia syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
• Locus ID: 2719
• MW: 15.8