DYRK1B (NM_006484) Human 3' UTR Clone

CAT#: SC204978

3' UTR clone of dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B (DYRK1B) transcript variant c for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "DYRK1B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DYRK1B
Synonyms AOMS3; MIRK
ACCN NM_006484
Insert Size 395 bp
Sequence Data
>SC204978 3’UTR clone of NM_006484
The sequence shown below is from the reference sequence of NM_006484. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTACCCCAGAGCACAGCAGCCAGCTCGTGACCCTGCCCCCTCCCTGGGGCCCCTCCTGAAGCCATACCC
TCCCCCATCTGGGGGCCCTGGGCTCCCATCCTCATCTCTCTCCTTGACTGGAATTGCTGCTACCCAGCT
GGGGTGGGTGAGGCCTGCACTGATTGGGGCCTGGGGCAGGGGGGTCAAGGAGAGGGTTTTGGCCGCTCC
CTCCCCACTAAGGACTGGACCCTTGGGCCCCTCTCCCCCTTTTTTTCTATTTATTGTACCAAAGACAGT
GGTGGTCCGGTGGAGGGAAGACCCCCCCTCACCCCAGGACCCTAGGAGGGGGTGGGGGCAGGTAGGGGG
AGATGGCCTTGCTCCTCCTCGCTGTACCCCCAGTAAAGAGCTTTCTCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_006484.3
Summary This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Locus ID 9149
MW 13.6

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.