APLP1 (NM_005166) Human 3' UTR Clone

CAT#: SC204787

3' UTR clone of amyloid beta (A4) precursor-like protein 1 (APLP1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: APLP1
• Synonyms: APLP
• ACCN: NM_005166
• Insert Size: 381 bp
• Sequence Data:
  Insert Sequence

  >SC204787 3’UTR clone of NM_005166
  The sequence shown below is from the reference sequence of NM_005166. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  ACTTACCGCTTCCTGGAGGAACGACCCTGACCCGGCCCCCTTCACCCCTTCAGCCGAGCCCAGACCTCC
  CCTCTTCCTGGAGCCCCAGAACCCCAACTCCCAGCCTAGGGCAGCAGGGAGTCTTGAAGTGATCATTTC
  ACACCCTTTTGTGAGACGGCTGGAAATTCTTATTTCCCCTTTCCAATTCCAAAATTCCATCCCTAAGAA
  TTCCCAGATAGTCCCAGCAGCCTCCCCACGTGGCACCTCCTCACCTTAATTTATTTTTTAAGTTTATTT
  ATGGCTCTTTAAGGTGACCGCCACCTTGGTCCTAGTGTCTATTCCCTGGAATTCACCCTCTCATGTTTC
  CCTACTAACATCCCAATAAAGTCCTCTTCCCTACCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005166.5
• Summary: This gene encodes a member of the highly conserved amyloid precursor protein gene family. The encoded protein is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. This cleavage liberates an intracellular cytoplasmic fragment that may act as a transcriptional activator. The encoded protein may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
• Locus ID: 333
• MW: 14.2