Adenine Nucleotide Translocator 2 (SLC25A5) (NM_001152) Human 3' UTR Clone

CAT#: SC204503

3' UTR clone of solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator) member 5 (SLC25A5) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SLC25A5
• Synonyms: 2F1; AAC2; ANT2; T2; T3
• ACCN: NM_001152
• Insert Size: 368 bp
• Sequence Data:
  Insert Sequence

  >SC204503 3’UTR clone of NM_001152
  The sequence shown below is from the reference sequence of NM_001152. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TTGTATGATGAAATCAAGAAGTACACATAAGTTATTTCCTAGGATTTTTCCCCCTGTGAACAGGCATGT
  TGTATTATATAACATATCTTGAGCATTCTTGACAGACTCCTGGCTGTCAGTTTCTCAGTGGCAACTATT
  TACTGGTTGAAAATGGGAAGCAATAATATTCATCTGACCAGTTTTCTCTTAAAGCCATTTCCATGATGA
  TGATGATGGGACTCAATTGTATTTTTTATTTCAGTCACTCCTGATAAATAACAAATTTGGAGAAATAAA
  AATATCTAAAATAAATTTTGTCTGCAGTATATTTTCATATAAAAATGCATATTTGAGTGCTACATTCGA
  ATAAATACTACCTTTTTAGTGAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001152.5
• Summary: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Suppressed expression of this gene has been shown to induce apoptosis and inhibit tumor growth. The human genome contains several non-transcribed pseudogenes of this gene.[provided by RefSeq, Jun 2013]
• Locus ID: 292
• MW: 14.4