SMOX (NM_175839) Human 3' UTR Clone

CAT#: SC204433

3' UTR clone of spermine oxidase (SMOX) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SMOX
• Synonyms: C20orf16; PAO; PAO-1; PAO1; PAOH; PAOH1; SMO
• ACCN: NM_175839
• Insert Size: 350 bp
• Sequence Data:
  Insert Sequence

  >SC204433 3’UTR clone of NM_175839
  The sequence shown below is from the reference sequence of NM_175839. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TACCGAGACCTCTTCCAGCAGGGGACCTGAGGGCTGTCCTCGCTGCTGAGAAGAGCCACTAACTCGTGA
  CCTCCAGCCTGCCCCTTGCTGCCGTGTGCTCCTGCCTTCCTGATCCTCTGTAGAAAGGATTTTTATCTT
  CTGTAGAGCTAGCCGCCCTGACTGCCTTCAGACCTGGCCCTGTAGCTTTTCTTTTTCTCCAGGCTGGGC
  CGTGAGCAGGTGGGCCGTTGAGTTACCTCTGTGCTGGATCCCGTGCCCCCACTTGCCTACCCTCTGTCC
  TGCCTTGTTATTGTAAGTGCCTTCAATACTTTGCATTTTGGGATAATAAAAAAGGCTCCCTCCCCTGCC
  CCTCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_175839.3
• Summary: Polyamines are ubiquitous polycationic alkylamines which include spermine, spermidine, putrescine, and agmatine. These molecules participate in a broad range of cellular functions which include cell cycle modulation, scavenging reactive oxygen species, and the control of gene expression. These molecules also play important roles in neurotransmission through their regulation of cell-surface receptor activity, involvement in intracellular signalling pathways, and their putative roles as neurotransmitters. This gene encodes an FAD-containing enzyme that catalyzes the oxidation of spermine to spermadine and secondarily produces hydrogen peroxide. Multiple transcript variants encoding different isoenzymes have been identified for this gene, some of which have failed to demonstrate significant oxidase activity on natural polyamine substrates. The characterized isoenzymes have distinctive biochemical characteristics and substrate specificities, suggesting the existence of additional levels of complexity in polyamine catabolism. [provided by RefSeq, Jul 2012]
• Locus ID: 54498
• MW: 12.7