GGT5 (NM_001099781) Human 3' UTR Clone

CAT#: SC204210

3' UTR clone of gamma-glutamyltransferase 5 (GGT5) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GGT5
• Synonyms: GGL; GGT-REL; GGT 5; GGTLA1
• ACCN: NM_001099781
• Insert Size: 363 bp
• Sequence Data:
  Insert Sequence

  >SC204210 3’UTR clone of NM_001099781
  The sequence shown below is from the reference sequence of NM_001099781. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AGGAAGAGTGGGGAGGCCGCAGGCTACTAAGACACTGCTCTGCCCAGAGCTGAAGTCTGGCCCCACCAT
  GAGTCCTGTGTCCAGGCCGGACATGGCTGGGGGACCAACTACTCTGGCAGGATCTGGACCCCTGGCAGG
  GGAGTCCAGCTGAGAGTGGAAGAGGTGGCGGGGACCAGCTGGGCAGATGAGAGGCTGAGCCTCATCCCT
  AACCCCCTTTCCCAGAGCCCCTGGTGGTCCTGAACCGGCCCCTCTATCCCTCCGCAGGCCTCTTGCCTG
  GGGCCACTCTCCCACCCTCTCGATCTGTATATCCTCCAGTCCAAGATTAAAGAGGCGGACTGTGGCCTG
  AAAAAAAAAAAAAAAAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001099781.2
• Summary: This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
• Locus ID: 2687
• MW: 13.3